Search results

Search for "DNA polymerase" in Full Text gives 27 result(s) in Beilstein Journal of Organic Chemistry.

Regioselective approach to 5-arylsulfonylisoxazoles and their antimicrobial activity

  • Artem S. Sazonov,
  • Dmitry A. Vasilenko,
  • Denis V. Porfiriev,
  • Yuri K. Grishin,
  • Rimma A. Gazzaeva,
  • Alisa P. Chernyshova,
  • Maxim A. Kryakvin,
  • Anna A. Baranova,
  • Vera A. Alferova and
  • Elena B. Averina

Beilstein J. Org. Chem. 2026, 22, 592–602, doi:10.3762/bjoc.22.45

Graphical Abstract
  • studies indicate that these compounds induce the bacterial SOS response without inhibiting DNA synthesis-related enzymes such as DNA polymerase I, DNA gyrase, or topoisomerases I and IV, suggesting activation via bacterial reductases. These findings highlight the potential of these isoxazole derivatives
  • SOS response is a global response to DNA damage which can occur due to several reasons, including, but not limited to, inhibition of enzymes such as DNA gyrase, DNA polymerase or topoisomerases I and IV. We conducted studies of inhibitory activity of samples 3h, 3g and 4b against the above-mentioned
  • enzymes as described previously [34]. Firstly, we conducted the Klenow fragment test to assess potential inhibitory activity on DNA polymerase I. The principal scheme of this test is shown in Figure 3A. Briefly, two primers (74 bases and 89 bases) anneal to each other, and the Klenow fragment of DNA
PDF
Album
Supp Info
Full Research Paper
Published 17 Apr 2026

Natural resorcylic lactones derived from alternariol

  • Joachim Podlech

Beilstein J. Org. Chem. 2024, 20, 2171–2207, doi:10.3762/bjoc.20.187

Graphical Abstract
PDF
Album
Supp Info
Review
Published 30 Aug 2024

Cofactor-independent C–C bond cleavage reactions catalyzed by the AlpJ family of oxygenases in atypical angucycline biosynthesis

  • Jinmin Gao,
  • Liyuan Li,
  • Shijie Shen,
  • Guomin Ai,
  • Bin Wang,
  • Fang Guo,
  • Tongjian Yang,
  • Hui Han,
  • Zhengren Xu,
  • Guohui Pan and
  • Keqiang Fan

Beilstein J. Org. Chem. 2024, 20, 1198–1206, doi:10.3762/bjoc.20.102

Graphical Abstract
  • cultures of S. ambofaciens ΔΔalpJW, respectively, as previously described [11][25]. E. coli strains were grown in lysogeny broth (LB) [42]. Restriction enzymes, T4 DNA ligase, and KOD DNA polymerase were purchased from New England BioLabs. FAD and NADPH were purchased from Sigma-Aldrich. DNA manipulation
PDF
Album
Supp Info
Full Research Paper
Published 23 May 2024

Genome mining of labdane-related diterpenoids: Discovery of the two-enzyme pathway leading to (−)-sandaracopimaradiene in the fungus Arthrinium sacchari

  • Fumito Sato,
  • Terutaka Sonohara,
  • Shunta Fujiki,
  • Akihiro Sugawara,
  • Yohei Morishita,
  • Taro Ozaki and
  • Teigo Asai

Beilstein J. Org. Chem. 2024, 20, 714–720, doi:10.3762/bjoc.20.65

Graphical Abstract
  • fungal natural products and biosynthetic machineries have been conducted, leading to the discovery of various new natural products and enzymes [19][20][21][22][23][24][25][26][27]. Although fungal LRDs are a biologically and pharmaceutically important class of natural products including DNA polymerase α
PDF
Album
Supp Info
Full Research Paper
Published 03 Apr 2024

Elucidating the glycan-binding specificity and structure of Cucumis melo agglutinin, a new R-type lectin

  • Jon Lundstrøm,
  • Emilie Gillon,
  • Valérie Chazalet,
  • Nicole Kerekes,
  • Antonio Di Maio,
  • Ten Feizi,
  • Yan Liu,
  • Annabelle Varrot and
  • Daniel Bojar

Beilstein J. Org. Chem. 2024, 20, 306–320, doi:10.3762/bjoc.20.31

Graphical Abstract
  • (ACACCTCGAGTTAGGGTTTGTACTGTGTCACGAACATCC). The primers contained the restriction sites (underlined) NcoI (sense) and XhoI (antisense) on their 5′-ends for further sub-cloning. PCR was performed using PrimeSTAR DNA polymerase. The purified PCR fragment of 395 bp was digested by NcoI and XhoI restriction enzymes, then ligated into pET40b
  • . This plasmid was obtained by PCR using pET-40b(+) (Novagen, Merck, #70091) as template and the following primers: forward (gcccagatctgggtaccGAAAACCTGTATTTTCAGGGCGccatggcgatatcgg) and reverse (GGTACCCAGATCTGGGCTGTCCATGTGCTGGC) with complementary sequence underlined. PCR was performed using PrimeSTAR DNA
  • polymerase (Takara #TAKR045A); then the product was digested by DpnI and finally transformed in NEB5α strain (New England Biolabs, #C2992H). Both gene and vector were digested by NcoI and XhoI restriction enzymes (New England Biolabs) prior to purification on agarose gel using Monarch Gel extraction kit and
PDF
Album
Supp Info
Full Research Paper
Published 19 Feb 2024

Identification of the new prenyltransferase Ubi-297 from marine bacteria and elucidation of its substrate specificity

  • Jamshid Amiri Moghaddam,
  • Huijuan Guo,
  • Karsten Willing,
  • Thomas Wichard and
  • Christine Beemelmanns

Beilstein J. Org. Chem. 2022, 18, 722–731, doi:10.3762/bjoc.18.72

Graphical Abstract
  • Kit (Qiagen) and PCR amplification of ubiA-297 (922 bp) and menA-1335 (952 bp) genes was carried out using S7 Fusion High-Fidelity DNA Polymerase (Biozym) and designated primer sequences (ubiA-297 forward 5’-CAGGATCCAGGATGTCCAATAAACTAATG-3’ reverse 5’-CGAAGCTTGTCTTAGGTAATGGCAAAAAG-3’; menA forward 5
PDF
Album
Supp Info
Full Research Paper
Published 22 Jun 2022

Synthetic strategies toward 1,3-oxathiolane nucleoside analogues

  • Umesh P. Aher,
  • Dhananjai Srivastava,
  • Girij P. Singh and
  • Jayashree B. S

Beilstein J. Org. Chem. 2021, 17, 2680–2715, doi:10.3762/bjoc.17.182

Graphical Abstract
  • counterparts during DNA or RNA synthesis, a biological role that is crucial for cellular reproduction [2]. Most of the drugs that are incorporated in the viral DNA upon phosphorylation in vivo block the DNA polymerase enzyme. However, DNA polymerase recognizes 2’,3’-dideoxynucleosides as substrates, which are
  • triphosphate substrate to bind to cellular DNA polymerase and viral reverse transcriptase [9]. The effectiveness of nucleoside analogues depends on the ability to replicate naturally occurring nucleosides, interfering with viral as well as cellular enzymes and hampering essential metabolism processes of
PDF
Album
Review
Published 04 Nov 2021

Chemical approaches to discover the full potential of peptide nucleic acids in biomedical applications

  • Nikita Brodyagin,
  • Martins Katkevics,
  • Venubabu Kotikam,
  • Christopher A. Ryan and
  • Eriks Rozners

Beilstein J. Org. Chem. 2021, 17, 1641–1688, doi:10.3762/bjoc.17.116

Graphical Abstract
PDF
Album
Review
Published 19 Jul 2021

Double-headed nucleosides: Synthesis and applications

  • Vineet Verma,
  • Jyotirmoy Maity,
  • Vipin K. Maikhuri,
  • Ritika Sharma,
  • Himal K. Ganguly and
  • Ashok K. Prasad

Beilstein J. Org. Chem. 2021, 17, 1392–1439, doi:10.3762/bjoc.17.98

Graphical Abstract
PDF
Album
Review
Published 08 Jun 2021

Antiviral therapy in shrimp through plant virus VLP containing VP28 dsRNA against WSSV

  • Santiago Ramos-Carreño,
  • Ivone Giffard-Mena,
  • Jose N. Zamudio-Ocadiz,
  • Alfredo Nuñez-Rivera,
  • Ricardo Valencia-Yañez,
  • Jaime Ruiz-Garcia,
  • Maria Teresa Viana and
  • Ruben D. Cadena-Nava

Beilstein J. Org. Chem. 2021, 17, 1360–1373, doi:10.3762/bjoc.17.95

Graphical Abstract
  • -glycosylase (UNG) activation; 10 min at 95 °C to activate AmpliTaq Fast DNA Polymerase and then, 40 cycles of 15 seconds at 95 °C and 1 min at 60 °C. For the WSSV quantification, a standard curve was obtained with the plasmid DNA with the vp664 gene of 69 bp [45][51] at a 1:10 dilution factor. The
PDF
Album
Supp Info
Full Research Paper
Published 01 Jun 2021

Biochemistry of fluoroprolines: the prospect of making fluorine a bioelement

  • Vladimir Kubyshkin,
  • Rebecca Davis and
  • Nediljko Budisa

Beilstein J. Org. Chem. 2021, 17, 439–460, doi:10.3762/bjoc.17.40

Graphical Abstract
  • packing effect has an implication on the thermostability of the triple helix [35][98][99]. In another study, fluoroprolines were incorporated in KlenTag DNA polymerase from a thermophilic organism, Thermus aquaticus [119]. The expression of the target protein was only observed with R-Flp, but not with S
  • subdomain [129], T. thermohydrosulfuricus lipase [130][131][132], human ubiquitin [133], single-chain Fv format protein [134], KlenTag DNA polymerase [135], thioredoxin A [120], β2-microglobulin [136], red fluorescent protein [137][138], Pin1 WW domain [139], bacteriophage T4 fibritin C-terminal domain [106
PDF
Album
Review
Published 15 Feb 2021

New standards for collecting and fitting steady state kinetic data

  • Kenneth A. Johnson

Beilstein J. Org. Chem. 2019, 15, 16–29, doi:10.3762/bjoc.15.2

Graphical Abstract
  • is so much slower than chemistry, the initial weak substrate binding and the conformational change are the primary determinants of specificity. DNA polymerase fidelity DNA polymerases provide ideal model systems to study enzyme specificity because fidelity is high and physiologically relevant, and
  • the alternate substrates are well known. Moreover, it is easy to perform single turnover kinetic measurements to examine steps leading up to the chemical reaction by mixing an enzyme DNA complex with only one nucleoside triphosphate. Recent work on DNA polymerase fidelity has shown that the rate of
  • of enzyme specificity because it commits the substrate to forward reaction. For the DNA polymerase studied, the rate of product release is much faster than chemistry so the model reduces to a three-step model. Accordingly the specificity constant is defined by the two-step binding reaction, while
PDF
Album
Review
Published 02 Jan 2019

Protein–protein interactions in bacteria: a promising and challenging avenue towards the discovery of new antibiotics

  • Laura Carro

Beilstein J. Org. Chem. 2018, 14, 2881–2896, doi:10.3762/bjoc.14.267

Graphical Abstract
  • to DnaG was predicted. Finally, the fragments were also assessed against other SSB partner proteins by means of STD-NMR. Although the affinity values were not determined, all of them were satisfactorily found to bind to E. coli PriA, E. coli RNAse HI and the χ subunit of E. coli and A. Baumannii DNA
  • polymerase III, and thus represent promising leads in the search for PPI inhibitors in bacteria. Filamenting temperature-sensitive protein Z (FtsZ) FtsZ is a prokaryotic tubulin-like protein which plays a crucial role in cell division in both Gram-positive and Gram-negative bacteria [83]. This protein
PDF
Album
Review
Published 21 Nov 2018

An overview of recent advances in duplex DNA recognition by small molecules

  • Sayantan Bhaduri,
  • Nihar Ranjan and
  • Dev P. Arya

Beilstein J. Org. Chem. 2018, 14, 1051–1086, doi:10.3762/bjoc.14.93

Graphical Abstract
  • activities were evaluated [102]. A molecular docking study has revealed that GRA interacts with ct-DNAs via hydrogen bonding interactions between the oxygen atoms of GRA and adenine bases of DNA and van der Waals interactions. Moreover, GRA significantly reduces the polymerization activity of DNA polymerase
PDF
Album
Review
Published 16 May 2018

Fluorogenic PNA probes

  • Tirayut Vilaivan

Beilstein J. Org. Chem. 2018, 14, 253–281, doi:10.3762/bjoc.14.17

Graphical Abstract
  • rolling circle amplification reaction (RCA) initiated by phi29 DNA polymerase to give a long tandem repeat DNA. As low as 0.4 pM of miRNA could be readily detected with single mismatch specificity [143]. In addition to the direct detection of DNA and RNA targets, the PNA–GO platform has also been used for
PDF
Album
Review
Published 29 Jan 2018

Fluorescent nucleobase analogues for base–base FRET in nucleic acids: synthesis, photophysics and applications

  • Mattias Bood,
  • Sangamesh Sarangamath,
  • Moa S. Wranne,
  • Morten Grøtli and
  • L. Marcus Wilhelmsson

Beilstein J. Org. Chem. 2018, 14, 114–129, doi:10.3762/bjoc.14.7

Graphical Abstract
  • and conformational changes using base–base FRET Many biologically important processes such as binding of transcription factors to DNA, polymerase–DNA interactions during replication, gene regulatory systems and structure variation due to changes in conditions (e.g., B-to-Z-form DNA), generally involve
PDF
Album
Review
Published 10 Jan 2018

Synthetic mRNA capping

  • Fabian Muttach,
  • Nils Muthmann and
  • Andrea Rentmeister

Beilstein J. Org. Chem. 2017, 13, 2819–2832, doi:10.3762/bjoc.13.274

Graphical Abstract
  • of the replicative DNA polymerase from Thermococcus gorgonarius (Tgo) into a DNA-dependent RNA polymerase (termed TGK) enabled production of up to 1,700 nt long RNAs from a ssDNA template and an RNA primer [119]. The primer-dependent RNA synthesis obviates the need to initiate RNA synthesis with pppG
PDF
Album
Review
Published 20 Dec 2017

Towards open-ended evolution in self-replicating molecular systems

  • Herman Duim and
  • Sijbren Otto

Beilstein J. Org. Chem. 2017, 13, 1189–1203, doi:10.3762/bjoc.13.118

Graphical Abstract
  • formed and the DNA has successfully become replicated. The replication of DNA however is a complex process mediated by enzymes such as DNA polymerase and topoisomerase. To better understand the origin of life and as a possible first step in the synthesis of de novo life it would be very interesting
PDF
Album
Review
Published 21 Jun 2017

From chemical metabolism to life: the origin of the genetic coding process

  • Antoine Danchin

Beilstein J. Org. Chem. 2017, 13, 1119–1135, doi:10.3762/bjoc.13.111

Graphical Abstract
PDF
Album
Review
Published 12 Jun 2017

Radical polymerization by a supramolecular catalyst: cyclodextrin with a RAFT reagent

  • Kohei Koyanagi,
  • Yoshinori Takashima,
  • Takashi Nakamura,
  • Hiroyasu Yamaguchi and
  • Akira Harada

Beilstein J. Org. Chem. 2016, 12, 2495–2502, doi:10.3762/bjoc.12.244

Graphical Abstract
  • catalyst; Introduction The folding of proteins in biological systems, the replication of DNA, and specific substrate recognition by enzymes play important roles in forming supramolecular structures, achieving functions, and maintaining life [1][2][3][4][5][6]. The crystal structures of RNA polymerase, DNA
  • polymerase, and λ-exonuclease demonstrate that the cylindrical cavities of enzymes can effectively recognize substrates to produce biological polymers [1][2][3][4][5][6]. Cyclodextrins (CDs) have been widely used as substrate-recognition moieties in artificial enzymes [7][8][9][10][11][12][13][14][15], which
PDF
Album
Supp Info
Full Research Paper
Published 22 Nov 2016

DNA display of glycoconjugates to emulate oligomeric interactions of glycans

  • Alexandre Novoa and
  • Nicolas Winssinger

Beilstein J. Org. Chem. 2015, 11, 707–719, doi:10.3762/bjoc.11.81

Graphical Abstract
  • enzymatically using glycan-functionalized desoxyuridine triphosphate as substrate with KOD Dash DNA polymerase [23]. The applicability of the method was illustrated with the incorporation of multiple units of lactose or maltose in different DNA sequences. The same group used this technology to prepare
PDF
Album
Review
Published 11 May 2015

Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

  • Kristen K. Merritt,
  • Kevin M. Bradley,
  • Daniel Hutter,
  • Mariko F. Matsuura,
  • Diane J. Rowold and
  • Steven A. Benner

Beilstein J. Org. Chem. 2014, 10, 2348–2360, doi:10.3762/bjoc.10.245

Graphical Abstract
  • single-stranded DNA molecules that include AEGIS components. OligArch designs these fragments so that, after they are annealed, the annealed fragments are extended by a DNA polymerase to fill in any gaps, the nicks in the resulting duplex are ligated (Figure 3 schematically, Figure 4 in detail), and the
  • synthesis from six phosphoramidites (four standard and two AEGIS). They were then mixed in equal amounts, heated and cooled. The 3’-fragments were then extended at 48 °C using Phusion DNA polymerase to give a nicked construct and the nicks were sealed with ligase. The first indication that the GACTSB AEGIS
  • annealed mixture were transferred to a new tube, and then diluted with a mixture of enzymes (total volume of mixture was 15 µL) containing PhusionTM DNA polymerase (1 U, New England Biolabs, final 0.07 U/µL), Taq DNA ligase (400 U, New England Biolabs, final 27 U/µL), ISO buffer, and dNTPs (final 0.2 mM
PDF
Album
Supp Info
Full Research Paper
Published 09 Oct 2014

Reversibly locked thionucleobase pairs in DNA to study base flipping enzymes

  • Christine Beuck and
  • Elmar Weinhold

Beilstein J. Org. Chem. 2014, 10, 2293–2306, doi:10.3762/bjoc.10.239

Graphical Abstract
  • opposing adenine, resulting in ring opening and formation of an ethylene cross-linked base pair [29][30]. Other aziridine-substituted nucleobases have been incorporated enzymatically by a DNA polymerase, but elongation past the modified nucleoside has not been reported [31]. Another approach uses
PDF
Album
Supp Info
Full Research Paper
Published 01 Oct 2014
Graphical Abstract
  • fragments so that the target DNA is produced after the fragments are annealed, after the annealed fragments are (optionally) extended by a DNA polymerase to fill in any gaps to give nicked DNA, after any nicks are sealed, and after the AEGIS pairs are replaced by standard pairs. OligArch also ensures that
PDF
Album
Full Research Paper
Published 11 Aug 2014

A new building block for DNA network formation by self-assembly and polymerase chain reaction

  • Holger Bußkamp,
  • Sascha Keller,
  • Marta Robotta,
  • Malte Drescher and
  • Andreas Marx

Beilstein J. Org. Chem. 2014, 10, 1037–1046, doi:10.3762/bjoc.10.104

Graphical Abstract
  • network formation by enzymatic DNA synthesis. The Y-shaped 3-armed DNA construct, bearing 3 primer strands is accepted by Taq DNA polymerase. The enzyme uses each arm as primer strand and incorporates the branched construct into large assemblies during PCR. The networks were investigated by agarose gel
  • hydrogels. Keywords: AFM; branched DNA; DNA; DNA polymerase; nanotechnology; nucleic acids; PCR; self-assembly; Introduction DNA has found applications in the field of nanotechnology due to its inherent properties. The simplicity and predictability of DNA secondary structure are of outstanding potential
  • , the formed DNA networks are remarkably stabilized (up to 95 °C) compared to the non-branched counterparts. We previously reported an approach to construct three dimensional DNA networks that were generated and amplified by DNA polymerase chain reactions (PCR). In order to construct the network we
PDF
Album
Supp Info
Full Research Paper
Published 07 May 2014
Other Beilstein-Institut Open Science Activities