Search results

Search for "PCR" in Full Text gives 65 result(s) in Beilstein Journal of Organic Chemistry.

Pyrene-modified PNAs: Stacking interactions and selective excimer emission in PNA2DNA triplexes

  • Alex Manicardi,
  • Lucia Guidi,
  • Alice Ghidini and
  • Roberto Corradini

Beilstein J. Org. Chem. 2014, 10, 1495–1503, doi:10.3762/bjoc.10.154

Graphical Abstract
  • the fluorescence properties can be observed upon interaction with DNA, thus enabling to study the occurring interactions and to produce switching PNA probes. Fluorescent switching probes for DNA detection are very useful tools in diagnostics applications such as real-time PCR and in situ hybridisation
PDF
Album
Supp Info
Full Research Paper
Published 02 Jul 2014

A new building block for DNA network formation by self-assembly and polymerase chain reaction

  • Holger Bußkamp,
  • Sascha Keller,
  • Marta Robotta,
  • Malte Drescher and
  • Andreas Marx

Beilstein J. Org. Chem. 2014, 10, 1037–1046, doi:10.3762/bjoc.10.104

Graphical Abstract
  • network formation by enzymatic DNA synthesis. The Y-shaped 3-armed DNA construct, bearing 3 primer strands is accepted by Taq DNA polymerase. The enzyme uses each arm as primer strand and incorporates the branched construct into large assemblies during PCR. The networks were investigated by agarose gel
  • hydrogels. Keywords: AFM; branched DNA; DNA; DNA polymerase; nanotechnology; nucleic acids; PCR; self-assembly; Introduction DNA has found applications in the field of nanotechnology due to its inherent properties. The simplicity and predictability of DNA secondary structure are of outstanding potential
  • , the formed DNA networks are remarkably stabilized (up to 95 °C) compared to the non-branched counterparts. We previously reported an approach to construct three dimensional DNA networks that were generated and amplified by DNA polymerase chain reactions (PCR). In order to construct the network we
PDF
Album
Supp Info
Full Research Paper
Published 07 May 2014

Intermediates in monensin biosynthesis: A late step in biosynthesis of the polyether ionophore monensin is crucial for the integrity of cation binding

  • Wolfgang Hüttel,
  • Jonathan B. Spencer and
  • Peter F. Leadlay

Beilstein J. Org. Chem. 2014, 10, 361–368, doi:10.3762/bjoc.10.34

Graphical Abstract
  • a decisive effect on the three-dimensional structure of the ionophore-cation complex, as revealed by X-ray crystal structure analysis of both dehydroxymonensin A and demethylmonensin A, each in complex with a sodium ion. Results and Discussion PCR-targetted in-frame deletions using the ReDirect [21
  • the S. cinnamonensis strain A519 [19] Redirect©-PCR-targeting technology was used according to the supplier's instructions [21][42]. The disruption cassettes were amplified from a HinDIII-EcoRI-fragment of pIJ773 with the following primers (5' to 3') monD: oD1for: CGGCCGCCACATTCCCCGACCTGGT
  • : CGCGAATTCTCATGTTTGACCGCTTA TCATCGATAAGCTTTCCCGCCAGCCTCGCAGAG; SCAT2rev: CACCGGAAGGAGCTGACTGGGTTGAAGGCTC TCAAGGGCGAAGTTCCTATACTTTCTA. The cosmids Cos2 (monE) and Cos11 (monD) from a cosmid library of S. cinnamonensis [16] were used as templates for PCR. All mutants were verified by sequencing on both forward and reverse
PDF
Album
Letter
Published 10 Feb 2014

Physalin H from Solanum nigrum as an Hh signaling inhibitor blocks GLI1–DNA-complex formation

  • Midori A. Arai,
  • Kyoko Uchida,
  • Samir K. Sadhu,
  • Firoj Ahmed and
  • Masami Ishibashi

Beilstein J. Org. Chem. 2014, 10, 134–140, doi:10.3762/bjoc.10.10

Graphical Abstract
  • annealing of single strand (ss) DNA; for biotin-labeled GLI1–BS, 5’-biotin-AGCTACCTGGGTGGTCTCTTCGA-3’ and 5’-biotin-TCGAAGAGACCACCCAGGTAGCT-3’. 10 μL of the ssDNA (100 pmol/μL in TE buffer (NIPPON GENE, Tokyo, Japan)) were mixed and annealed by PCR Thermal Cycler Dice (Takara, Kyoto, Japan) (95 °C, 30 s; 72
PDF
Album
Full Research Paper
Published 13 Jan 2014

SF002-96-1, a new drimane sesquiterpene lactone from an Aspergillus species, inhibits survivin expression

  • Silke Felix,
  • Louis P. Sandjo,
  • Till Opatz and
  • Gerhard Erkel

Beilstein J. Org. Chem. 2013, 9, 2866–2876, doi:10.3762/bjoc.9.323

Graphical Abstract
  • highest concentration tested (8 µM). To investigate the effect of the compound on the transcription of the survivin gene, quantitative real-time PCR experiments were performed with total RNA isolated from Colo 320 cells treated with different concentrations of the test compound for 8 h as described in the
  • experimental section. As illustrated in Figure 4B, application of 18.42 µM (7 µg/mL) SF002-96-1 reduced the survivin mRNA level in Colo 320 cells by around 50%. To confirm the data obtained from the qRT-PCR experiments, Western blot experiments were performed for survivin protein expression. As shown in Figure
  • compound could affect the binding of Stat3 and NF-κB to the survivin promoter in living cells, we performed ChIP assays with primers covering suggested Stat3 and NF-κB (p65) binding sites [23][24]. Q-PCR of the −1231/−1009 (primers Sat3_1), −131/+46 (primers Stat3_2) and −920/−773 (primers Stat3_3) regions
PDF
Album
Supp Info
Full Research Paper
Published 13 Dec 2013

Activation of cryptic metabolite production through gene disruption: Dimethyl furan-2,4-dicarboxylate produced by Streptomyces sahachiroi

  • Dinesh Simkhada,
  • Huitu Zhang,
  • Shogo Mori,
  • Howard Williams and
  • Coran M. H. Watanabe

Beilstein J. Org. Chem. 2013, 9, 1768–1773, doi:10.3762/bjoc.9.205

Graphical Abstract
  • . The S. sahachiroi/ΔaziA2 disruptants were confirmed by PCR and Southern hybridization of thiostrepton resistant and apramycin sensitive colonies. Direct comparison of HPLC profiles of the wild-type and ΔaziA2 crude organic extracts were striking (Figure 2). The ΔaziA2 mutant gave a single major peak
  • , plasmids, PCR primer sequences, and bacterial culture conditions. Construction of disruption plasmid pKCAziA2 Disruption of aziA2 was performed using a homologous recombination approach with pKC1139. PCR with primer pairs aziA2UF/aziA2UR and aziA2DF/aziA2DR was utilized to generate a 930 bp upstream
  • . sahachiroi/ΔaziA2) and PCR performed. The AziA2UF/TsrR and TsrF/AziA2DR primer set was utilized: initial denaturation at 98 °C for 30 s; 30 total cycles of denaturation for 10 s; annealing at 64.5 °C for 40 s; polymerization at 72 °C for 60 s and finally gap filing at 72 °C for 10 min. Southern hybridization
PDF
Album
Supp Info
Letter
Published 29 Aug 2013

Isotopically labeled sulfur compounds and synthetic selenium and tellurium analogues to study sulfur metabolism in marine bacteria

  • Nelson L. Brock,
  • Christian A. Citron,
  • Claudia Zell,
  • Martine Berger,
  • Irene Wagner-Döbler,
  • Jörn Petersen,
  • Thorsten Brinkhoff,
  • Meinhard Simon and
  • Jeroen S. Dickschat

Beilstein J. Org. Chem. 2013, 9, 942–950, doi:10.3762/bjoc.9.108

Graphical Abstract
  • obtained plasmid that already carried the dmdA gene region. P. gallaeciensis DSM 17395 was transformed by electroporation with this plasmid, leading to the strain CZ01 (dmdA::kan), which was ratified by PCR. General synthetic methods: Chemicals were purchased from Acros Organics (Geel, Belgium) or Sigma
PDF
Album
Supp Info
Full Research Paper
Published 15 May 2013

Recent progress in the discovery of small molecules for the treatment of amyotrophic lateral sclerosis (ALS)

  • Allison S. Limpert,
  • Margrith E. Mattmann and
  • Nicholas D. P. Cosford

Beilstein J. Org. Chem. 2013, 9, 717–732, doi:10.3762/bjoc.9.82

Graphical Abstract
  • genes were also elevated in the spinal cords of treated mice as analyzed by RT-PCR. Importantly, treatment of SOD1 G93A mice with 28 or 29 resulted in reduced weight loss, decreased motor decline and increased lifespan [64]. Using a virtual screening system to discover oxidative-stress-reducing agents
PDF
Album
Supp Info
Review
Published 15 Apr 2013

The use of glycoinformatics in glycochemistry

  • Thomas Lütteke

Beilstein J. Org. Chem. 2012, 8, 915–929, doi:10.3762/bjoc.8.104

Graphical Abstract
  • glycan chain, and by glycoside hydrolases (GH) that remove specific monosaccharides [3]. For this reason there is no technique available to amplify carbohydrates comparable to Polymerase Chain Reaction (PCR) or protein expression systems. Instead, carbohydrates have to be analyzed in physiological
PDF
Album
Review
Published 21 Jun 2012

Diarylethene-modified nucleotides for switching optical properties in DNA

  • Sebastian Barrois and
  • Hans-Achim Wagenknecht

Beilstein J. Org. Chem. 2012, 8, 905–914, doi:10.3762/bjoc.8.103

Graphical Abstract
  • linker between the chromophore and DNA base as the point of attachment. The purpose of this conformationally flexible tether is to overcome problems in the enzymatic activity by DNA polymerases in the context of primer-extension (PEX) or PCR studies [35][36][37]. However, the shortest possible linking of
  • polymerase-assisted PEX and PCR experiments, an absolutely critical issue regarding the application of single C–C bonds, or ethinyl or phenylene linkers is the question of whether the canonical base-recognition complementarity is effected by the chromophore modification [42][43]. Due to the strongest
PDF
Album
Video
Full Research Paper
Published 20 Jun 2012

An easily accessible sulfated saccharide mimetic inhibits in vitro human tumor cell adhesion and angiogenesis of vascular endothelial cells

  • Grazia Marano,
  • Claas Gronewold,
  • Martin Frank,
  • Anette Merling,
  • Christian Kliem,
  • Sandra Sauer,
  • Manfred Wiessler,
  • Eva Frei and
  • Reinhard Schwartz-Albiez

Beilstein J. Org. Chem. 2012, 8, 787–803, doi:10.3762/bjoc.8.89

Graphical Abstract
  • 20% (v/v) FBS (Biochrom, Berlin, Germany), 1 μg/mL hydrocortisone, 0.1 ng/mL human epidermal growth factor and 1ng/mL human basal fibroblast growth factor, as recommended by the manufacturer. Cells used for the assays described below were mycoplasm free as verified by DAPI-staining of DNA and a PCR
PDF
Album
Full Research Paper
Published 29 May 2012

Chemo-enzymatic modification of poly-N-acetyllactosamine (LacNAc) oligomers and N,N-diacetyllactosamine (LacDiNAc) based on galactose oxidase treatment

  • Christiane E. Kupper,
  • Ruben R. Rosencrantz,
  • Birgit Henßen,
  • Helena Pelantová,
  • Stephan Thönes,
  • Anna Drozdová,
  • Vladimir Křen and
  • Lothar Elling

Beilstein J. Org. Chem. 2012, 8, 712–725, doi:10.3762/bjoc.8.80

Graphical Abstract
  • -transferase was cloned from an expression plasmid previously used by our group [54]. NdeI and XhoI restriction sites were incorporated by PCR. The primer sequences were: 5′-GGGAATTCCATATGGGCCATCATCATCATCATCACAGTTCGAGTGTCGAGAC-3′ and 3′-CCGTCTGTTTTCTCATATTAAACCAATCTTTATTACAGATTATTGAGCTCCGCCC-5′. The insert was
PDF
Album
Supp Info
Full Research Paper
Published 09 May 2012

Mutational analysis of a phenazine biosynthetic gene cluster in Streptomyces anulatus 9663

  • Orwah Saleh,
  • Katrin Flinspach,
  • Lucia Westrich,
  • Andreas Kulik,
  • Bertolt Gust,
  • Hans-Peter Fiedler and
  • Lutz Heide

Beilstein J. Org. Chem. 2012, 8, 501–513, doi:10.3762/bjoc.8.57

Graphical Abstract
  • of the pIJ773 cassette harbouring an apramycin resistance gene, the disruption cassette was excised by FLP recombinase. The correct sequence of the resulting cosmid ppzOS21 was confirmed by restriction analysis and PCR. Cosmid ppzOS21 was introduced into S. coelicolor M512 by triparental mating, and
  • . Escherichia coli XL1 Blue MRF, E. coli SURE (Stratagene, Heidelberg, Germany), E. coli BW 25113, and E. coli ET 12567 (pUB307) were used for cloning and were grown in liquid or on solid (1.5% agar) Luria-Bertani or SOB medium at 37 °C. The REDIRECT technology kit for PCR targeting was obtained from Plant
  • . Lysozyme was from Boehringer Ingelheim, Heidelberg, Germany. Genetic procedures Standard methods for DNA isolation and manipulation were performed as described by Kieser et al. [36] and Sambrook et al. [39]. DNA fragments were isolated from agarose gels by using a PCR purification kit (Amersham Biosciences
PDF
Album
Supp Info
Full Research Paper
Published 04 Apr 2012

Multicomponent synthesis of artificial nucleases and their RNase and DNase activity

  • Anton V. Gulevich,
  • Lyudmila S. Koroleva,
  • Olga V. Morozova,
  • Valentina N. Bakhvalova,
  • Vladimir N. Silnikov and
  • Valentine G. Nenajdenko

Beilstein J. Org. Chem. 2011, 7, 1135–1140, doi:10.3762/bjoc.7.131

Graphical Abstract
  • groups as well as various aliphatic linkers. With these diamides in hand we began the investigation of their biological activity. Currently, real-time PCR is the better method for the quantitation of the target nucleic acids because of its high specificity and sensitivity of up to a few genome
  • with 2.5 mM aqueous solutions of peptidomimetics 5a–g for 2 hours at 37 °C. Denaturating electrophoresis in SDS-agarose gel revealed complete cleavage of the total RNA (Supporting Information File 1, Figure S1) and RT-real time PCR showed complete destruction of the TBEV RNA (Figure 2). Compounds 5e
  • and Figure 4). Results of RT-real time PCR (Figure 3) and electrophoresis RT-qPCR products in 2% TBE-agarose gel (Figure 4) showed varying degrees of destruction of the TBEV RNA, respectively. To analyze DNase activity of the novel compounds, both double-stranded circular recombinant plasmid DNA with
PDF
Album
Supp Info
Full Research Paper
Published 19 Aug 2011

Miniemulsion polymerization as a versatile tool for the synthesis of functionalized polymers

  • Daniel Crespy and
  • Katharina Landfester

Beilstein J. Org. Chem. 2010, 6, 1132–1148, doi:10.3762/bjoc.6.130

Graphical Abstract
  • synthesis to carry out a polymerase chain reaction (PCR) in crosslinked starch nanocapsules [121]. The permeability of the shell was also evaluated by fluorescence spectroscopy. The combination of cleavable polyurethane [109] with the interfacial polyaddition described above [116] afforded polymer shells
PDF
Album
Video
Full Research Paper
Published 01 Dec 2010
Other Beilstein-Institut Open Science Activities