Chemical and biosynthetic potential of Penicillium shentong XL-F41

• Ran Zou,
• Xin Li,
• Xiaochen Chen,
• Yue-Wei Guo and
• Baofu Xu

Beilstein J. Org. Chem. 2024, 20, 597–606, doi:10.3762/bjoc.20.52

• -monooxygenase, to form quinoline rings [26]. Quinine is frequently cited as one of the primary forms of quinoline rings in secondary metabolic pathways. Francesco Trenti et al. [27] studied some of the biosynthesis processes of quinine, in which enzymes involved are much more complex than primary metabolism

• , such as medium-chain alcohol dehydrogenase (CpDCS), esterase (CpDCE), P450 and O-methyltransferase (CpOMT1) (Figure S37). Through genome excavation and analysis of Penicillium shentong XL-F41, a significant difference was discovered between the key enzymes involved in the formation of product compound

A myo-inositol dehydrogenase involved in aminocyclitol biosynthesis of hygromycin A

• Michael O. Akintubosun and
• Melanie A. Higgins

Beilstein J. Org. Chem. 2024, 20, 589–596, doi:10.3762/bjoc.20.51

• annotations and in vivo studies [8]. However, validation by in vitro approaches or biochemical analysis of the individual enzymes is lacking. Here, we verify that Hyg17 is a myo-inositol dehydrogenase and show that it has a distinct substrate scope. In addition, we use sequence similarity networks to compare

• is a myo-inositol dehydrogenase. These types of enzymes typically use NAD+ as a cofactor [12][13]. So, we first tested Hyg17 with myo-inositol and NAD+ and found that it was able to produce NADH, suggesting it can function as a myo-inositol dehydrogenase (Figure 2a). Since this assay tests for the

• Bacillus subtilis, BsIDH, has an optimal pH between 9.5–10 [12][13]. We also compared product formation between reactions with Hyg17 or BsIDH and myo-inositol using thin-layer chromatography (Supporting Information File 1, Figure S3). We found that both enzymes generated a ketone product with identical

Recent developments in the engineered biosynthesis of fungal meroterpenoids

• Zhiyang Quan and
• Takayoshi Awakawa

Beilstein J. Org. Chem. 2024, 20, 578–588, doi:10.3762/bjoc.20.50

• mutagenesis of key enzymes, including terpene cyclases and α-ketoglutarate (αKG)-dependent dioxygenases, that contribute to the structural diversity. Notable progress in genome sequencing has led to the discovery of many novel genes encoding these enzymes, while continued efforts in X-ray crystallographic

• analyses of these enzymes and the invention of AlphaFold2 have facilitated access to their structures. Structure-based mutagenesis combined with applications of unnatural substrates has further diversified the catalytic repertoire of these enzymes. The information in this review provides useful knowledge

• will be discussed as examples of engineering biosynthetic pathways and key enzymes involved in fungal meroterpenoid biosynthesis. Furthermore, a construction of the artificial biosynthetic pathway composed of the fungal meroterpenoids pathway and the pathway from other species, in fungal host

Synthesis and biological profile of 2,3-dihydro[1,3]thiazolo[4,5-b]pyridines, a novel class of acyl-ACP thioesterase inhibitors

• Jens Frackenpohl,
• David M. Barber,
• Guido Bojack,
• Birgit Bollenbach-Wahl,
• Ralf Braun,
• Rahel Getachew,
• Sabine Hohmann,
• Kwang-Yoon Ko,
• Karoline Kurowski,
• Bernd Laber,
• Rebecca L. Mattison,
• Thomas Müller,
• Anna M. Reingruber,
• Dirk Schmutzler and
• Andrea Svejda

Beilstein J. Org. Chem. 2024, 20, 540–551, doi:10.3762/bjoc.20.46

• with emphasis on the structural diversity of small-molecule ligands. In this context, acyl-acyl carrier protein (acyl-ACP) thioesterase inhibitors have shown a remarkable variability. Fatty acid thioesterase (FAT) enzymes represent a family of proteins exclusively found in higher plants. They mediate

Development of a chemical scaffold for inhibiting nonribosomal peptide synthetases in live bacterial cells

• Fumihiro Ishikawa,
• Sho Konno,
• Hideaki Kakeya and
• Genzoh Tanabe

Beilstein J. Org. Chem. 2024, 20, 445–451, doi:10.3762/bjoc.20.39

• investigated the influence of a modification of 2′-OH in the AMS scaffold with different functional groups on binding to target enzymes and bacterial cell penetration. The inhibitor 7 with a cyanomethyl group at 2′-OH showed desirable inhibitory activity against both recombinant and intracellular gramicidin S

• probes (AA-AMS-BPyne) can selectively label the A-domains corresponding to the amino acid of the ligand in both recombinant enzymes and proteomes. We recently reported that these probes can be used to label the A-domains of endogenous NRPSs in live bacterial cells [17][18][19]. The intracellular labeling

Discovery of unguisin J, a new cyclic peptide from Aspergillus heteromorphus CBS 117.55, and phylogeny-based bioinformatic analysis of UngA NRPS domains

• Sharmila Neupane,
• Marcelo Rodrigues de Amorim and
• Elizabeth Skellam

Beilstein J. Org. Chem. 2024, 20, 321–330, doi:10.3762/bjoc.20.32

• discovered that linearized the cyclic unguisins to linear peptides during in vitro investigations, although the linear peptides were not detected from the fungal cultures. NRPS enzymes are large multifunctional enzymes that often synthesize very important bioactive molecules [11][12]. These enzymes consist

• , from Aspergillus heteromorphus CBS 117.55. We also perform bioinformatic analysis of the A and C domains of the UngA NRPS enzymes involved in their biosynthesis to try and rationalize the relaxed substrate specificity observed in this family of heptapeptides. Results and Discussion The cultivation of A

Elucidating the glycan-binding specificity and structure of Cucumis melo agglutinin, a new R-type lectin

• Jon Lundstrøm,
• Emilie Gillon,
• Valérie Chazalet,
• Nicole Kerekes,
• Antonio Di Maio,
• Ten Feizi,
• Yan Liu,
• Annabelle Varrot and
• Daniel Bojar

Beilstein J. Org. Chem. 2024, 20, 306–320, doi:10.3762/bjoc.20.31

• polymerase (Takara #TAKR045A); then the product was digested by DpnI and finally transformed in NEB5α strain (New England Biolabs, #C2992H). Both gene and vector were digested by NcoI and XhoI restriction enzymes (New England Biolabs) prior to purification on agarose gel using Monarch Gel extraction kit and

• (ACACCTCGAGTTAGGGTTTGTACTGTGTCACGAACATCC). The primers contained the restriction sites (underlined) NcoI (sense) and XhoI (antisense) on their 5′-ends for further sub-cloning. PCR was performed using PrimeSTAR DNA polymerase. The purified PCR fragment of 395 bp was digested by NcoI and XhoI restriction enzymes, then ligated into pET40b

Photoinduced in situ generation of DNA-targeting ligands: DNA-binding and DNA-photodamaging properties of benzo[c]quinolizinium ions

• Julika Schlosser,
• Olga Fedorova,
• Yuri Fedorov and
• Heiko Ihmels

Beilstein J. Org. Chem. 2024, 20, 101–117, doi:10.3762/bjoc.20.11

• a change of the DNA structure or occupy binding sites of essential enzymes, which in turn may influence or even inhibit important biochemical processes, for example DNA replication or transcription [1][2]. As a result, the development of DNA-targeting drugs still involves the design of suitable DNA

Identification of the p-coumaric acid biosynthetic gene cluster in Kutzneria albida: insights into the diazotization-dependent deamination pathway

• Seiji Kawai,
• Akito Yamada,
• Yohei Katsuyama and
• Yasuo Ohnishi

Beilstein J. Org. Chem. 2024, 20, 1–11, doi:10.3762/bjoc.20.1

• -nitrosuccinate), from the study on cremeomycin biosynthesis [4][5]. The ANS pathway is composed of two enzymes, CreE (FAD-dependent monooxygenase) and CreD (lyase), to synthesize nitrous acid from ʟ-aspartate and the nitrous acid is used to synthesize the diazo group of cremeomycin [4]. After the discovery of

• the ANS pathway, it has been shown that the ANS pathway is involved in the nitrogen–nitrogen (N–N) bond formation in the biosynthesis of several natural products [6][7][8]. Enzymes that catalyze N–N bond formation by using nitrous acid from the ANS pathway have also been characterized in several

• acid through a completely different pathway, which requires at least 12 enzymes and two carrier proteins if two primary metabolites (dihydroxyacetone phosphate and aspartate-4-semialdehyde) are considered as starting materials. Thus, the Cma system appears to be more complicated than the general p

Long oligodeoxynucleotides: chemical synthesis, isolation via catching-by-polymerization, verification via sequencing, and gene expression demonstration

• Yipeng Yin,
• Reed Arneson,
• Alexander Apostle,
• Adikari M. D. N. Eriyagama,
• Komal Chillar,
• Emma Burke,
• Martina Jahfetson,
• Yinan Yuan and
• Shiyue Fang

Beilstein J. Org. Chem. 2023, 19, 1957–1965, doi:10.3762/bjoc.19.146

• employed to assemble the 399 and 401 bp dsODNs, which were originated from the chemically synthesized 399 and 401 nt ssODNs, into the pF1k T7 Flexi® vector. To do this, the pF1k vector was cut with PmeI and SgfI restriction enzymes. The linearized vector was purified with agarose gel electrophoresis. The

Studying specificity in protein–glycosaminoglycan recognition with umbrella sampling

• Mateusz Marcisz,
• Sebastian Anila,
• Margrethe Gaardløs,
• Martin Zacharias and
• Sergey A. Samsonov

Beilstein J. Org. Chem. 2023, 19, 1933–1946, doi:10.3762/bjoc.19.144

• proteins or nucleic acids, GAGs are constantly altered by processing enzymes and thus they vary greatly in molecular mass, disaccharide unit composition, and sulfation. Based on their core structure they are categorized into six different classes, viz. heparan sulfate (HS), heparin (HP), hyaluronic acid

Anion–π catalysis on carbon allotropes

• M. Ángeles Gutiérrez López,
• Mei-Ling Tan,
• Giacomo Renno,
• Augustina Jozeliūnaitė,
• J. Jonathan Nué-Martinez,
• Javier Lopez-Andarias,
• Naomi Sakai and
• Stefan Matile

Beilstein J. Org. Chem. 2023, 19, 1881–1894, doi:10.3762/bjoc.19.140

• selectivity and access to completely new reactions. Internal electric fields have been shown to account for much of the power of enzymes [41][42][43]. The translation of these lessons from nature into OEEF catalysis has so far been slow for a series of most demanding challenges [32][33][34][35][36][37][38][39

Radical chemistry in polymer science: an overview and recent advances

• Zixiao Wang,
• Feichen Cui,
• Yang Sui and
• Jiajun Yan

Beilstein J. Org. Chem. 2023, 19, 1580–1603, doi:10.3762/bjoc.19.116

• action of laccase enzymes [5]. The radical then rearranges to form a semiquinone radical and reacts rapidly with a neighboring urushiol molecule to produce a biphenyl dimer. The dimers further polymerize to form the polymer [8]. Radical processes also occur in oceans. The mussel attachment system

Functions of enzyme domains in 2-methylisoborneol biosynthesis and enzymatic synthesis of non-natural analogs

• Binbin Gu,
• Lin-Fu Liang and
• Jeroen S. Dickschat

Beilstein J. Org. Chem. 2023, 19, 1452–1459, doi:10.3762/bjoc.19.104

• of the 2-methylisoborneol synthase was investigated through enzyme incubations with several substrate analogs, giving access to two C12 monoterpenoids. Implications on the stereochemical course of the terpene cyclisation by 2-methylisoborneol synthase are discussed. Keywords: biosynthesis; enzymes

• diphosphate synthase (FPPS) and 2MIBS from Streptomyces coelicolor [26] (Scheme 1B). Crystal structures of both enzymes have been obtained [27][28] and allowed for a deep structure-based investigation of 2MIBS through site-directed mutagenesis [29]. The predicted amino acid sequences of 2MIBS homologs from

• ) Enzyme precipitation after 12 h in elution buffer at 4 °C. The biosynthesis of 2-methylisoborneol (1). A) SAM-dependent methylation of GPP to 2-Me-GPP by GPPMT and terpene cyclisation to 1 by 2MIBS. B) Non-natural formation using the enzymes humMT for the methylation of DMAPP to 2-Me-IPP, FPPS for the

Functional characterisation of twelve terpene synthases from actinobacteria

• Anuj K. Chhalodia,
• Houchao Xu,
• Georges B. Tabekoueng,
• Binbin Gu,
• Kizerbo A. Taizoumbe,
• Lukas Lauterbach and
• Jeroen S. Dickschat

Beilstein J. Org. Chem. 2023, 19, 1386–1398, doi:10.3762/bjoc.19.100

• synthase homologs from diverse actinobacteria that were selected based on a phylogenetic analysis of more than 4000 amino acid sequences were investigated for their products. For four enzymes with functions not previously reported from bacterial terpene synthases the products were isolated and their

• identified by GC–MS. The characterised enzymes include a new epi-isozizaene synthase with monoterpene synthase side activity, a 7-epi-α-eudesmol synthase that also produces hedycaryol and germacrene A, and four more sesquiterpene synthases that produce mixtures of hedycaryol and germacrene A. Three

• phylogenetically related enzymes were in one case not expressed and in two cases inactive, suggesting pseudogenisation in the respective branch of the phylogenetic tree. Furthermore, a diterpene synthase for allokutznerene and a sesterterpene synthase for sesterviolene were identified. Keywords: actinomycetes

Radical ligand transfer: a general strategy for radical functionalization

• David T. Nemoto Jr,
• Kang-Jie Bian,
• Shih-Chieh Kao and
• Julian G. West

Beilstein J. Org. Chem. 2023, 19, 1225–1233, doi:10.3762/bjoc.19.90

• body’s own cytochrome P450 enzymes. These catalysts exhibit unique “radical rebound” reactivity at their heme active sites (Scheme 1) [12], a mechanism proposed by Groves and co-workers and heavily explored beginning in the 1970s [13][14]. This two-step functionalization sequence begins with HAT from an

• . Similar RLT “rebound” steps have been implicated in non-heme oxygenase and halogenase enzymes as well [16][17][18][19], hinting that this strategy might be general; however, enzymatic examples outside of hydroxo and halide ligand transfer are scarce. Groves’ initial discovery of the radical rebound

• enzymes consists of HAT on a C–H bond, followed by RLT with a hydroxy ligand. II: Kochi reported the oxidation of alkyl radicals through LMCT of copper(II) chloride and subsequent radical chlorine ligand transfer [26]. 1-Cyclohexene was also reported to be oxidized to the vicinal dichlorinated product

Enabling artificial photosynthesis systems with molecular recycling: A review of photo- and electrochemical methods for regenerating organic sacrificial electron donors

• Grace A. Lowe

Beilstein J. Org. Chem. 2023, 19, 1198–1215, doi:10.3762/bjoc.19.88

• of enzymes [47]. The enzymes reduce carbon dioxide to methanol and consumed NADH which was then recycled at the photoelectrode functionalized with the rhodium complex. The overall electron donor in this work was water which makes it an excellent example of in-situ recycling. Kuk et al. also noted

• that [CpRh(bpy)(H2O)]2+ could slowly produce formate, a key biocatalytic intermediate, in the absence of the enzymes but they validated their system by proving that overall the formate production and conversion to methanol by the biocatalytic enzyme cascade far outcompeted any side-reactions. Ishitani

Intermediates and shunt products of massiliachelin biosynthesis in Massilia sp. NR 4-1

• Till Steinmetz,
• Blaise Kimbadi Lombe and
• Markus Nett

Beilstein J. Org. Chem. 2023, 19, 909–917, doi:10.3762/bjoc.19.69

• ] and the photoxenobactins [32]. A unifying theme in the biosynthesis of these natural products is the use of a thiotemplate-based assembly strategy [33]. The molecular building blocks that are needed for the biosynthesis are covalently bound via thioester bonds to multi-domain enzymes. The domains

Cyclodextrins as building blocks for new materials

• Miriana Kfoury and
• Sophie Fourmentin

Beilstein J. Org. Chem. 2023, 19, 889–891, doi:10.3762/bjoc.19.66

• science that require high performance with minimal environmental impact. They are involved in the construction of interlocked molecules (rotaxanes and catenanes), supramolecular polymers, artificial enzymes, hydrogels, metal–organic frameworks, supramolecular solvents, fibers, nanotubes, nanoparticles

Synthesis of imidazo[1,2-a]pyridine-containing peptidomimetics by tandem of Groebke–Blackburn–Bienaymé and Ugi reactions

• Oleksandr V. Kolomiiets,
• Alexander V. Tsygankov,
• Maryna N. Kornet,
• Aleksander A. Brazhko,
• Vladimir I. Musatov and
• Valentyn A. Chebanov

Beilstein J. Org. Chem. 2023, 19, 727–735, doi:10.3762/bjoc.19.53

• ], olprinon (cardiotonic agent for the treatment of acute heart failure) [18], GSK812397 (with anti-human immunodeficiency virus (HIV) properties) [19] (Figure 1). In light of the numerous viral epidemics and even pandemics, antiviral drugs that can inhibit the activity of proteins and enzymes encoded by

Palladium-catalyzed enantioselective three-component synthesis of α-arylglycine derivatives from glyoxylic acid, sulfonamides and aryltrifluoroborates

• Bastian Jakob,
• Nico Schneider,
• Luca Gengenbach and
• Georg Manolikakes

Beilstein J. Org. Chem. 2023, 19, 719–726, doi:10.3762/bjoc.19.52

• production of drugs, fertilizers, (biodegradable) polymers or nutritional supplements [2]. More importantly, α-amino acids form the backbone of all proteins and enzymes are therefore essential for almost all biological processes. In the last twenty years non-proteinogenic and chemically synthesized unnatural

Synthesis of medium and large phostams, phostones, and phostines

• Jiaxi Xu

Beilstein J. Org. Chem. 2023, 19, 687–699, doi:10.3762/bjoc.19.50

• prepared in good yields following the same procedure (Scheme 4) [28]. To prepare new inhibitors and therapeutical agents of relevant protease enzymes, (4-allyl-2-(4-methylphenyl)benzo[b]thiophen-3-yl)methyl benzyl allylphosphonate (25) was prepared in 90% yield from (4-allyl-2-(4-methylphenyl)benzo[b

pH-Responsive fluorescent supramolecular nanoparticles based on tetraphenylethylene-labelled chitosan and a six-fold carboxylated tribenzotriquinacene

• Nan Yang,
• Yi-Yan Zhu,
• Wei-Xiu Lin,
• Yi-Long Lu and
• Wen-Rong Xu

Beilstein J. Org. Chem. 2023, 19, 635–645, doi:10.3762/bjoc.19.45

• extensive attention owing to their potential applications in biomedicine, chemical sensing and as catalysts [1][2]. It is possible to regulate the formation and breakdown of supramolecular structures using external stimuli, such as pH, light, temperature, enzymes, and competing reagents [3][4]. Among these

Total synthesis: an enabling science

• Bastien Nay

Beilstein J. Org. Chem. 2023, 19, 474–476, doi:10.3762/bjoc.19.36

• (biomimetic synthesis) [14]. In addition, total syntheses have also been achieved with enzymes, strengthening the links to biology [15]. Total synthesis is not limited to academic laboratories but rather also pursued in industry, where a particular efficiency and economy of tasks is of paramount importance

Dipeptide analogues of fluorinated aminophosphonic acid sodium salts as moderate competitive inhibitors of cathepsin C

• Karolina Wątroba,
• Małgorzata Pawełczak and
• Marcin Kaźmierczak

Beilstein J. Org. Chem. 2023, 19, 434–439, doi:10.3762/bjoc.19.33

• development of fluorinated aminophosphonate-based inhibitors. Keywords: aminophosphonates; cathepsin C; dipeptide; fluorine; solvolysis; Introduction Cathepsin C, also known as dipeptidyl peptidase I (DPPI) belongs to the family of lysosomal cysteine proteases encompassing 11 human enzymes (cathepsins B, C