How and why kinetics, thermodynamics, and chemistry induce the logic of biological evolution

• Addy Pross and
• Robert Pascal

Beilstein J. Org. Chem. 2017, 13, 665–674, doi:10.3762/bjoc.13.66

• biological systems would evolve towards systems exhibiting maximum entropy production is contradicted by the high yield that is observed in the conversion of nutrients into cell components, as for instance during glucose metabolism. In this case entropy production only slightly exceeds the minimum required

Transition-metal-catalyzed synthesis of phenols and aryl thiols

• Yajun Liu,
• Shasha Liu and
• Yan Xiao

Beilstein J. Org. Chem. 2017, 13, 589–611, doi:10.3762/bjoc.13.58

• important roles in C–O coupling reactions for the synthesis of phenols from aryl halides. In 2011, the Sekar group used D-glucose as ligand and reported a Cu(OAc)2 catalyzed synthesis of phenols from aryl halides in the presence of KOH in DMSO/H2O (1:1) at 120 °C (Scheme 12) [34]. Aryl iodides and electron

• -deficient aryl bromides provided good to excellent yields. D-Glucose represents a type of environmentally friendly ligand and can be easily removed during the work-up process. This work is of special value as it was the first report employing copper(II) as the catalyst in the synthesis of phenols. In 2011

• of aryl halides using DMEDA as ligand. Hydroxylation of aryl halides using PAO as ligand. Hydroxylation of aryl halides using D-glucose as ligand. Hydroxylation of aryl halides using INDION-770 as ligand. PEG-400 mediated hydroxylation of aryl halides. Hydroxylation of aryl halides using glycolic

Novel β-cyclodextrin–eosin conjugates

• Gábor Benkovics,
• Damien Afonso,
• András Darcsi,
• Szabolcs Béni,
• Sabrina Conoci,
• Éva Fenyvesi,
• Lajos Szente,
• Milo Malanga and
• Salvatore Sortino

Beilstein J. Org. Chem. 2017, 13, 543–551, doi:10.3762/bjoc.13.52

• products confirm the characteristic signal pattern of a 6-substituted β-CD, having the C6 carbon atom of the substituted glucose unit shifted towards lower fields (42.27 ppm) (Figure S24 and Figure S32 in Supporting Information File 1). This chemical shift of the C6 carbon atom of the substituted glucose

Investigation of the action of poly(ADP-ribose)-synthesising enzymes on NAD⁺ analogues

• Sarah Wallrodt,
• Edward L. Simpson and
• Andreas Marx

Beilstein J. Org. Chem. 2017, 13, 495–501, doi:10.3762/bjoc.13.49

• tankyrases ARTD5 and ARTD6 also exhibit a unique domain structure consisting of multiple ankyrin repeats mediating protein–protein interactions [13]. Tankyrases are involved in telomere homeostasis, Wnt/β-catenin signalling, glucose metabolism, and cell cycle progression [14]. Remarkable efforts have been

Biosynthetic origin of butyrolactol A, an antifungal polyketide produced by a marine-derived Streptomyces

• Enjuro Harunari,
• Hisayuki Komaki and
• Yasuhiro Igarashi

Beilstein J. Org. Chem. 2017, 13, 441–450, doi:10.3762/bjoc.13.47

• investigate this possibility, we conducted a feeding experiment of [U-13C6]glucose which could label carbons derived from malonyl-CoA and hydroxymalonyl-ACP. In the 13C NMR spectrum, 13C–13C couplings were observed for C-1/C-2, C-3/C-4, C-5/C-6, C-7/C-8 in addition to the carbon pairs C-11/C-12, C-13/C-14, C

• -15/C-16, C-17/C-18, C-19/C-20, and C-21/C-22 (Table 1, Figure S3 in Supporting Information File 1). The 2D-INADEQUATE spectrum showed cross peaks for the above-mentioned two-carbon units derived from the glycolytic degradation of [U-13C6]glucose (Table 1, Figure 4b). Combined with the acetate

• experimentally identified the precursor of a tert-butyl group in a polyketide backbone. The unusual contiguous polyol system comprising eight hydroxylated carbons was proved to be arising from the chain extension using hydroxymalonyl-ACP by labeling experiments of [1,2-13C2]acetate and [U-13C6]glucose. This

Structure–efficiency relationships of cyclodextrin scavengers in the hydrolytic degradation of organophosphorus compounds

• Sophie Letort,
• Michaël Bosco,
• Benedetta Cornelio,
• Frédérique Brégier,
• Sébastien Daulon,
• Géraldine Gouhier and
• François Estour

Beilstein J. Org. Chem. 2017, 13, 417–427, doi:10.3762/bjoc.13.45

• monofunctionalized derivatives. However, the synergistic effect was regiodependent and only observed with the imidazole substituent located in position 2 of one methylated glucose unit and the α nucleophile in position 3 of the adjacent methylated glucose unit (compound 1, Figure 2). Herein we present an extended

Total synthesis of a Streptococcus pneumoniae serotype 12F CPS repeating unit hexasaccharide

• Peter H. Seeberger,
• Claney L. Pereira and
• Subramanian Govindan

Beilstein J. Org. Chem. 2017, 13, 164–173, doi:10.3762/bjoc.13.19

• unselective β-mannoside formation step we resorted to glucose–mannose conversion by inversion of the C2 stereocenter following selective installation of a trans-glucosidic linkage. Differentially protected thioglucoside 11 [22] is equipped with a participating C2 levulinyl ester that is replaced by an axial

Phosphated cyclodextrins as water-soluble chiral NMR solvating agents for cationic compounds

• Cira Mollings Puentes and
• Thomas J. Wenzel

Beilstein J. Org. Chem. 2017, 13, 43–53, doi:10.3762/bjoc.13.6

• . Cyclodextrins (CDs), which are cyclic oligosaccharides containing D-glucose units, represent an important and versatile class of chiral NMR solvating agents (Figure 1). The most common representatives are α-, β- and γ-CD, which contain six, seven and eight glucose rings, respectively. Many substrates form

Synthesis of multi-lactose-appended β-cyclodextrin and its cholesterol-lowering effects in Niemann–Pick type C disease-like HepG2 cells

• Keiichi Motoyama,
• Rena Nishiyama,
• Yuki Maeda,
• Taishi Higashi,
• Yoichi Ishitsuka,
• Yuki Kondo,
• Tetsumi Irie,
• Takumi Era and
• Hidetoshi Arima

Beilstein J. Org. Chem. 2017, 13, 10–18, doi:10.3762/bjoc.13.2

• children, results in severe hepatosplenomegaly and neurodegeneration [3][6]. Hence, the sequestration of cholesterol is an important factor in the development of the NPC disease. Cyclodextrins (CDs) are cyclic glucose oligosaccharides used by the pharmaceutical industry to enhance solubility, stability

• , corresponding to tri-, tetra-, penta-, hexa- and hepta-lactose-substituted β-CDs, respectively (Figure 2A). Further, the 1H NMR spectrum indicated that the degree of substitution of lactose (DSL) was 5.6. This value was obtained from the integral values of the anomeric protons of lactose and glucose in β-CD

Stabilization of nanosized titanium dioxide by cyclodextrin polymers and its photocatalytic effect on the degradation of wastewater pollutants

• Tamás Zoltán Agócs,
• István Puskás,
• Erzsébet Varga,
• Mónika Molnár and
• Éva Fenyvesi

Beilstein J. Org. Chem. 2016, 12, 2873–2882, doi:10.3762/bjoc.12.286

• oligosaccharides consisting of 6–8 glucose units (α-, β- and γ-CD) primarily used in the pharmaceutical, cosmetic and household chemical industry [8]. They form non-covalent inclusion complexes with a great number of the organic contaminants in soil (petroleum hydrocarbons, polycyclic aromatic hydrocarbons, etc

Biochemical and structural characterisation of the second oxidative crosslinking step during the biosynthesis of the glycopeptide antibiotic A47934

• Veronika Ulrich,
• Clara Brieke and
• Max J. Cryle

Beilstein J. Org. Chem. 2016, 12, 2849–2864, doi:10.3762/bjoc.12.284

• electron supply to the P450s (Figure 3) [38]. NADH was additionally regenerated throughout the assay via a glucose/glucose oxidase couple. The assay was stopped by cleaving the peptide from the PCP-X constructs using excess of methylamine and the peptide was then purified by solid phase extraction before

Interactions between cyclodextrins and cellular components: Towards greener medical applications?

• Loïc Leclercq

Beilstein J. Org. Chem. 2016, 12, 2644–2662, doi:10.3762/bjoc.12.261

• measurements, the binding constants can be estimated. The obtained results reveal that D-ribose, D- and L-arabinose, D-xylose, D-lyxose, D-2-deoxyribose, and methyl β-D-ribopyranoside were complexed by β-CD (binding constants ≤14 M−1). In contrast, aldohexoses and their derivatives (D-glucose, D-galactose, D

• important for determining the structure and for the selectivity of the complex. It is noteworthy that several other publications have studied the interaction of D-glucose with native CDs. For instance, Hirsh and co-workers estimated the binding constants of D-glucose to α-CD and β-CD at 450 and 420 M−1

• , respectively, from blood glucose meter [96]. In contrast, Hacket et al. determined the binding constant of D-glucose to β-CD at 0.6 M−1 by fluorimetric competition titrations [97]. The results obtained by Hacket et al. are closer to the values published by Aoyama and co-workers. In addition, it is quite

Synthesis of polyhydroxylated decalins via two consecutive one-pot reactions: 1,4-addition/aldol reaction followed by RCM/syn-dihydroxylation

• Michał Malik and
• Sławomir Jarosz

Beilstein J. Org. Chem. 2016, 12, 2602–2608, doi:10.3762/bjoc.12.255

• subsequent syn-dihydroxylation with the re-use of Ru catalyst. These transformations applied to optically pure 4,5,6-tribenzyloxycyclohexenone 17 derived from D-glucose gave the desired bicyclic structures in good yields and very good diastereoselectivities. To sum up, the proposed methodology is an

Useful access to enantiomerically pure protected inositols from carbohydrates: the aldohexos-5-uloses route

• Felicia D’Andrea,
• Giorgio Catelani,
• Lorenzo Guazzelli and
• Venerando Pistarà

Beilstein J. Org. Chem. 2016, 12, 2343–2350, doi:10.3762/bjoc.12.227

• aqueous NaOH followed by NaBH4 reduction of the crude inosose mixture. Although these pioneering results were not of synthetic significance, they elucidated for the first time the biosynthetic correlation between D-glucose and myo-inositol through the intermediate formation of D-xylo-hexos-5-ulose. A more

Enduracididine, a rare amino acid component of peptide antibiotics: Natural products and synthesis

• Darcy J. Atkinson,
• Briar J. Naysmith,
• Daniel P. Furkert and
• Margaret A. Brimble

Beilstein J. Org. Chem. 2016, 12, 2325–2342, doi:10.3762/bjoc.12.226

• β-hydroxyenduracididine by Oberthür et al.: In 2009, Oberthür et al. reported a synthetic route to azide derivatives of β-hydroxyenduracididine [56]. The synthesis hinged on the use of azide 34 as a common intermediate to access both diastereomers. Diacetone D-glucose 35 was converted to azide 34 in

A detailed view on 1,8-cineol biosynthesis by Streptomyces clavuligerus

• Jan Rinkel,
• Patrick Rabe,
• Laura zur Horst and
• Jeroen S. Dickschat

Beilstein J. Org. Chem. 2016, 12, 2317–2324, doi:10.3762/bjoc.12.225

• done in liquid 65 Gym medium (4 g yeast extract, 4 g glucose, 10 g malt extract, 1 L water, pH 7.2) and isolation of genomic DNA was performed using a standard protocol. The gene WP_003952918 encoding the 1,8-cineol synthase was amplified using forward primer (ATGCCCGCCGGCCACGAAGA) and reversed primer

• cerevisiae FY834 together with linearised vector pYE-Express [32] (EcoRI and HindIII digestion) using the LiOAc/SS carrier DNA protocol [39]. Transformed cells were plated on SM-URA medium (20 g glucose, 1.7 g yeast nitrogen base, 5 g ammonium sulphate, 0.77 g nutritional supplement minus uracil, 24 g agar

Isosorbide and dimethyl carbonate: a green match

• Fabio Aricò and
• Pietro Tundo

Beilstein J. Org. Chem. 2016, 12, 2256–2266, doi:10.3762/bjoc.12.218

• glucose by hydrolysis. Hydrogenation of glucose to D-sorbitol. An appropriate catalyst for this process should provide both acid sites (hydrolysis) and metallic sites (hydrogenation). Thus, several bifunctional catalytic systems have been investigated [40][41][42][43][44]. The use of ionic liquids as

• glucose via biotechnological and chemocatalytic depolymerization of polysaccharides. The conversion of D-sorbitol into isosorbide via sorbitan is then usually performed by a twofold dehydration reaction using different types of catalysts (Scheme 1) [49][50][51][52][53][54][55][56][57][58][59][60]. In 1968

Superelectrophilic activation of 5-hydroxymethylfurfural and 2,5-diformylfuran: organic synthesis based on biomass-derived products

• Dmitry S. Ryabukhin,
• Dmitry N. Zakusilo,
• Mikhail O. Kompanets,
• Anton A.Tarakanov,
• Irina A. Boyarskaya,
• Tatiana O. Artamonova,
• Mikhail A. Khohodorkovskiy,
• Iosyp O. Opeida and
• Aleksander V. Vasilyev

Beilstein J. Org. Chem. 2016, 12, 2125–2135, doi:10.3762/bjoc.12.202

• -glucose or D-fructose followed by oxidation to 2,5-DFF. X-ray crystal structure of compounds 5a (a), and 5c (b) (ORTEP diagrams, ellipsoid contour of probability levels is 50%, CCDC reference numbers 5a: 1483523, 5c: 1483524). Protonation of 5-HMF (1a) and 2,5-DFF (2) leading to cationic species A, B, C

Varioloid A, a new indolyl-6,10b-dihydro-5aH-[1]benzofuro[2,3-b]indole derivative from the marine alga-derived endophytic fungus Paecilomyces variotii EN-291

• Peng Zhang,
• Xiao-Ming Li,
• Xin-Xin Mao,
• Attila Mándi,
• Tibor Kurtán and
• Bin-Gui Wang

Beilstein J. Org. Chem. 2016, 12, 2012–2018, doi:10.3762/bjoc.12.188

• isolation: The fungus was statically cultivated in a 1000 mL Erlenmeyer flask containing 300 mL of the PDB medium (potato dextrose broth: 2% mannitol, 1% glucose, 0.3% peptone, 0.5% yeast extract, and 300 mL of seawater, 60 flasks) for 30 days at room temperature. The fermented substrate (18 L) was

Synthesis and NMR studies of malonyl-linked glycoconjugates of N-(2-aminoethyl)glycine. Building blocks for the construction of combinatorial glycopeptide libraries

• Markus Nörrlinger,
• Sven Hafner and
• Thomas Ziegler

Beilstein J. Org. Chem. 2016, 12, 1939–1948, doi:10.3762/bjoc.12.183

• quantitative yield by subjection 7 to a saturated solution of NH3 in MeOH (7 N) (Scheme 2). In addition to the monomeric glycoconjugates 1a–d and 2a–d we also prepared dimer 4 from the glucose containing conjugate 2a and the N-acetylglucosamine containing conjugate 1c. Treatment of 1c with 20% piperidine in

• temperature are marked. A) Missing correlation between the amidic proton and the methylene or 2-aminoethyl protons of the PNA backbone; B) Observed NOE-correlations of PNA building block 1a. Synthesis of building blocks 1a–d and 2a–d (a stands for D-glucose, b stands for D-galactose, c stands for N

Cross-linked cyclodextrin-based material for treatment of metals and organic substances present in industrial discharge waters

• Élise Euvrard,
• Nadia Morin-Crini,
• Coline Druart,
• Justine Bugnet,
• Bernard Martel,
• Cesare Cosentino,
• Virginie Moutarlier and
• Grégorio Crini

Beilstein J. Org. Chem. 2016, 12, 1826–1838, doi:10.3762/bjoc.12.172

• glucose units in the polymer. In the range of 50–110 ppm, the CH2 signals of CD (C-6, C-6’ and C-7) are completely hidden by the C-2, C-3 and C-5 peaks of the glucopyranose units. In the MAS spectrum, three CH2 signals are clear and the signals at 65, 62.1 and 60.2 ppm are attributable to CH2 in positions

Synthesis of the C8’-epimeric thymine pyranosyl amino acid core of amipurimycin

• Pramod R. Markad,
• Navanath Kumbhar and
• Dilip D. Dhavale

Beilstein J. Org. Chem. 2016, 12, 1765–1771, doi:10.3762/bjoc.12.165

• -glucose derived alcohol 3 in 13 steps and 14% overall yield. Thus, the Sharpless asymmetric epoxidation of allyl alcohol 7 followed by trimethyl borate mediated regio-selective oxirane ring opening with azide, afforded azido diol 10. The acid-catalyzed 1,2-acetonide ring opening in 10 concomitantly led to

• D-serine as a starting material [6]. In this regard, our group has recently reported the synthesis of the C3’-branched carbohydrate core of amipurimycin starting from D-glucose [15]. In the continuation of this area, we now report the synthesis of the amipurimycin pyranose core comprising of (a) a

• an azide nucleophile. The synthesis of allyl alcohol C from D-glucose was reported by us earlier. Our synthesis started with the homoallyl alcohol 3 (with defined ‘R’ absolute configuration at the C3-quaternary center) that is obtained from D-glucose as reported earlier by us in 37% overall yield [15

Automated glycan assembly of a S. pneumoniae serotype 3 CPS antigen

• Markus W. Weishaupt,
• Stefan Matthies,
• Mattan Hurevich,
• Claney L. Pereira,
• Heung Sik Hahm and
• Peter H. Seeberger

Beilstein J. Org. Chem. 2016, 12, 1440–1446, doi:10.3762/bjoc.12.139

• serotype 3 oligosaccharides have been developed and were applied to other uronic acid containing carbohydrate structures [21][22]. The first method uses only glucose building blocks to assemble oligosaccharides and introduces the C6 carboxylic acid moieties via a late-stage oxidation. Using this method

• -automation chemical modifications and the loss of product, we assembled pneumococcal serotype 3 CPS structures utilizing glucose and glucuronic acid monosaccharide building blocks and thus avoided late-stage oxidations. Results and Discussion Mindful of this strategic framework, glucuronic acid building

• block 1 was designed (Figure 2). A levulinoyl (Lev) ester was chosen as temporary protecting group (TPG) since the Fmoc (fluorenylmethoxycarbonyl) group led to a loss of stereocontrol during glycosylations with this glucuronic acid (GlcA) building block (data not shown). Glucose building blocks 2 and 3

Mutagenic activity of quaternary ammonium salt derivatives of carbohydrates

• Barbara Dmochowska,
• Karol Sikora,
• Anna Woziwodzka,
• Jacek Piosik and
• Beata Podgórska

Beilstein J. Org. Chem. 2016, 12, 1434–1439, doi:10.3762/bjoc.12.138

• . The polymers (oligosaccharides) of D-glucose found, for example, in wood (cellulose) and D-glucosamine present in shells of crabs and insects (chitin), are the widely known ones [1][2]. Another class of carbohydrate biopolymer derivatives – D-ribose and 2-deoxy-D-ribose – constitutes the backbone of

Elucidation of a masked repeating structure of the O-specific polysaccharide of the halotolerant soil bacteria Azospirillum halopraeferens Au4

• Elena N. Sigida,
• Yuliya P. Fedonenko,
• Alexander S. Shashkov,
• Nikolay P. Arbatsky,
• Evelina L. Zdorovenko,
• Svetlana A. Konnova,
• Vladimir V. Ignatov and
• Yuriy A. Knirel

Beilstein J. Org. Chem. 2016, 12, 636–642, doi:10.3762/bjoc.12.62

• , one- and two-dimensional 1H and 13C NMR spectroscopy. The following masked repeating structure of the O-specific polysaccharide was established: →3)-α-L-Rhap2Me-(1→3)-[β-D-Glcp-(1→4)]-α-D-Fucp-(1→2)-β-D-Xylp-(1→, where non-stoichiometric substituents, an O-methyl group (~45%) and a side-chain glucose

• carbohydrate and glycolipid parts [15] followed by fractionation of the released water-soluble carbohydrate portion by Sephadex G-50 Superfine size-exclusion chromatography. It was demonstrated that the OPS contained 2-O-methyl-6-deoxyhexose, L-rhamnose (Rha), D-fucose (Fuc), D-xylose (Xyl), and D-glucose (Glc