Photocatalyzed elaboration of antibody-based bioconjugates

• Marine Le Stum,
• Eugénie Romero and
• Gary A. Molander

Beilstein J. Org. Chem. 2025, 21, 616–629, doi:10.3762/bjoc.21.49

• directly to target cells via the antibody without affecting normal, healthy tissue. Importantly, the use of antibodies in modern medicine is not restricted solely to ADCs and cancer therapy. For example, mABs now find routine use in the context of radionuclide (PET) imaging agents, informing therapeutic

Red light excitation: illuminating photocatalysis in a new spectrum

• Lucas Fortier,
• Corentin Lefebvre and
• Norbert Hoffmann

Beilstein J. Org. Chem. 2025, 21, 296–326, doi:10.3762/bjoc.21.22

• plausible mechanisms: a photoinduced electron transfer (PET) between the 3MLCT state of the copper complex and DCA or a triplet–triplet energy transfer (TTET) between the 3MLCT state of the copper complex and DCA. In both of these mechanisms, the involvement of a doublet excited-state of the radical anion

• bacteriochlorin for photoinduced electron transfer-reversible addition-fragmentation chain transfer (PET-RAFT) polymerization under far-red light (Figure 4) [43]. This synthetic bacteriochlorin, structurally modified from tetraphenylporphyrin with two reduced pyrrole rings, exhibits strong absorption in the far

Advances in the use of metal-free tetrapyrrolic macrocycles as catalysts

• Mandeep K. Chahal

Beilstein J. Org. Chem. 2024, 20, 3085–3112, doi:10.3762/bjoc.20.257

• and a photosensitizer, facilitating photoinduced electron transfer (PET) to form the active cation radical B, and intersystem crossing (ISC) for energy transfer to generate the triplet carbene C. Radical B then reacted with biradical C, producing the new radical D, which accepted an electron from the

• the electrochemical and photochemical properties of the catalyst was crucial for facilitating photoelectron transfer (PET) processes in these photoredox systems. De Oliveira and co-workers reported metal-free porphyrins as photoredox catalysts for the synthesis of α-arylketones/aldehydes by arylation

Tunable full-color dual-state (solution and solid) emission of push–pull molecules containing the 1-pyrindane moiety

• Anastasia I. Ershova,
• Sergey V. Fedoseev,
• Konstantin V. Lipin,
• Mikhail Yu. Ievlev,
• Oleg E. Nasakin and
• Oleg V. Ershov

Beilstein J. Org. Chem. 2024, 20, 3016–3025, doi:10.3762/bjoc.20.251

• ], positron emission tomography (PET) imaging [24], fluorescent probes and labels [25][26][27] detecting H2S in foodstuff, water, and living cells [28], Fe3+ ions [29], Hg2+ ions [30], and cyanide anions [31], for acid–base vapor sensing [32], and as candidate material for photonics devices, optical switches

Anion-dependent ion-pairing assemblies of triazatriangulenium cation that interferes with stacking structures

• Yohei Haketa,
• Takuma Matsuda and
• Hiromitsu Maeda

Beilstein J. Org. Chem. 2024, 20, 2567–2576, doi:10.3762/bjoc.20.215

• been widely investigated in the past decades for application as fluorescent dyes [3][4][5], chirality inducers [6][7][8], acceptors for photoinduced electron transfer (PET) [9][10], and components of supramolecular assemblies [11][12][13][14]. Owing to the stable π-electronic systems showing unique

• ] formed a charge-by-charge assembled structure, with alternate stacking of TATA+ and PCCp− through iπ–iπ interactions in the crystal state [20][21]. Charge-by-charge stacking assemblies of 1a+ and porphyrin-based π-electronic anions showed the crystal-state PET between proximally located anions and

Phenylseleno trifluoromethoxylation of alkenes

• Clément Delobel,
• Armen Panossian,
• Gilles Hanquet,
• Frédéric R. Leroux,
• Fabien Toulgoat and
• Thierry Billard

Beilstein J. Org. Chem. 2024, 20, 2434–2441, doi:10.3762/bjoc.20.207

• experimental and analytical data and NMR spectra. Acknowledgements The NMR Center and the Mass Spectrometry Center are acknowledged for their analysis. Funding The authors are grateful to the French National Research Agency (ANR; grant no. 20-CE07-0004-02, Ap-PET-I). The CNRS, the French Ministry of Education

The Groebke–Blackburn–Bienaymé reaction in its maturity: innovation and improvements since its 21st birthday (2019–2023)

• Cristina Martini,
• Muhammad Idham Darussalam Mardjan and
• Andrea Basso

Beilstein J. Org. Chem. 2024, 20, 1839–1879, doi:10.3762/bjoc.20.162

Benzylic C(sp³)–H fluorination

• Alexander P. Atkins,
• Alice C. Dean and
• Alastair J. J. Lennox

Beilstein J. Org. Chem. 2024, 20, 1527–1547, doi:10.3762/bjoc.20.137

• from financial and waste perspectives when compared to reagents such as Selectfluor and NFSI [75][76][77]. This type of fluorine source is also preferred for positron emission tomography (PET) imaging with [18F]fluoride [78]. Despite the challenges associated with nucleophilic fluoride, including

Auxiliary strategy for the general and practical synthesis of diaryliodonium(III) salts with diverse organocarboxylate counterions

• Naoki Miyamoto,
• Daichi Koseki,
• Kohei Sumida,
• Elghareeb E. Elboray,
• Naoko Takenaga,
• Ravi Kumar and
• Toshifumi Dohi

Beilstein J. Org. Chem. 2024, 20, 1020–1028, doi:10.3762/bjoc.20.90

• presence or absence of transition metal catalysts under thermal or photochemical conditions [2][3][4][5]. Furthermore, these compounds have practical applications in the synthesis of radiochemicals utilized in positron emission tomography (PET) imaging [6], as well as serving as photoacid generators for

Activity assays of NnlA homologs suggest the natural product N-nitroglycine is degraded by diverse bacteria

• Kara A. Strickland,
• Brenda Martinez Rodriguez,
• Ashley A. Holland,
• Shelby Wagner,
• Michelle Luna-Alva,
• David E. Graham and
• Jonathan D. Caranto

Beilstein J. Org. Chem. 2024, 20, 830–840, doi:10.3762/bjoc.20.75

• pET-28a(+)-TEV by GenScript. For protein expression, plasmids were electroporated into E. coli BL21(DE3) cells and protein was expressed and purified by immobilized metal affinity chromatography (IMAC) as previously described for Vs NnlA [21]. The only modification was that plasmids using pET-28a

Advancements in hydrochlorination of alkenes

• Daniel S. Müller

Beilstein J. Org. Chem. 2024, 20, 787–814, doi:10.3762/bjoc.20.72

• state thereof, denoted with an asterisk, possessing a reduction potential of 2.0 V versus SCE (saturated calomel electrode). Subsequently, this excited state undergoes quenching through photoinduced electron transfer (PET) with styrene 5. The resulting vinyl radical cation exhibits electrophilicity at

Elucidating the glycan-binding specificity and structure of Cucumis melo agglutinin, a new R-type lectin

• Jon Lundstrøm,
• Emilie Gillon,
• Valérie Chazalet,
• Nicole Kerekes,
• Antonio Di Maio,
• Ten Feizi,
• Yan Liu,
• Annabelle Varrot and
• Daniel Bojar

Beilstein J. Org. Chem. 2024, 20, 306–320, doi:10.3762/bjoc.20.31

• . This plasmid was obtained by PCR using pET-40b(+) (Novagen, Merck, #70091) as template and the following primers: forward (gcccagatctgggtaccGAAAACCTGTATTTTCAGGGCGccatggcgatatcgg) and reverse (GGTACCCAGATCTGGGCTGTCCATGTGCTGGC) with complementary sequence underlined. PCR was performed using PrimeSTAR DNA

Photoinduced in situ generation of DNA-targeting ligands: DNA-binding and DNA-photodamaging properties of benzo[c]quinolizinium ions

• Julika Schlosser,
• Olga Fedorova,
• Yuri Fedorov and
• Heiko Ihmels

Beilstein J. Org. Chem. 2024, 20, 101–117, doi:10.3762/bjoc.20.11

• intermediates (Scheme 4). Under anaerobic conditions, the DNA damage is similar to the one observed with the isomeric benzo[c]quinolizinium ions [35]. In the latter case, it has been shown that frank DNA-strand breaks are induced by hydroxyl radicals, supposedly formed by photoinduced electron transfer (PET

Radical chemistry in polymer science: an overview and recent advances

• Zixiao Wang,
• Feichen Cui,
• Yang Sui and
• Jiajun Yan

Beilstein J. Org. Chem. 2023, 19, 1580–1603, doi:10.3762/bjoc.19.116

• . Therefore, RAFT is often used to perform chain expansion reactions or to synthesize functionalized multi-block copolymers [62][63][64]. Boyer and co-workers developed a photocatalytically mediated RAFT polymerization, PET-RAFT, which removes the requirement for conventional radical initiators. The reaction

• well-defined polymer brushes from polymer surfaces [170][171]. Photoinduced processes, including photoATRP and PET-RAFT were used [172][173][174][175]. Poly(aryl ether ketone)s such as poly(ether ether ketone), bearing a diaryl ketone moiety resembling that of benzophenone, can generate biradicals upon

Radical ligand transfer: a general strategy for radical functionalization

• David T. Nemoto Jr,
• Kang-Jie Bian,
• Shih-Chieh Kao and
• Julian G. West

Beilstein J. Org. Chem. 2023, 19, 1225–1233, doi:10.3762/bjoc.19.90

• important medical radioisotope used for positron emission tomography (PET) [43]. Optimized conditions of both isotopes included fast reaction times of under two hours; in the case of the 18F radioisotope, reactions were carried out in 10 minutes and resulted in moderate to high yields, demonstrating the

Photoredox catalysis harvesting multiple photon or electrochemical energies

• Mattia Lepori,
• Simon Schmid and
• Joshua P. Barham

Beilstein J. Org. Chem. 2023, 19, 1055–1145, doi:10.3762/bjoc.19.81

• photoexcited catalyst must be able to engage substrates/intermediates in PET to achieve a redox neutral process. In the latter, following the first photoinduced electron transfer (PET) step a subsequent electrochemical SET occurs in the same redox direction and this subsequent SET is user-tunable by the

• ., through protonation and successive reduction or HAT) that upon excitation also acts as a super-reductant (Figure 8C). Simultaneously, Jacobi von Wangelin, Pérez-Ruiz and co-workers introduced the structurally related 9,10-dicyanoanthracene (DCA) as a conPET catalyst. Excitation of PET-generated radical

• electrogeneration favor a preassembly with Ar−X that i) upon photoexcitation accesses excited states higher than the first (D1) to bolster reactivity and/or ii) following PET assists in the Ar−X•− fragmentation step. The scope was expanded using triethylphosphite (P(OEt)3), dimethyl disulfide (MeSSMe) and bis

Combining the best of both worlds: radical-based divergent total synthesis

• Kyriaki Gennaiou,
• Antonios Kelesidis,
• Maria Kourgiantaki and
• Alexandros L. Zografos

Beilstein J. Org. Chem. 2023, 19, 1–26, doi:10.3762/bjoc.19.1

• radical to circumvent the unsuccessful Friedel–Crafts reaction. Prior reports implicated β-keto radical formation in the ring opening of siloxycyclopropanes with photoinduced electron transfer (PET) to 1,4-dicyanonaphthalene [65]. Inspired by reports on dual photoredox and Ni-catalytic cross-coupling

Thermally activated delayed fluorescence (TADF) emitters: sensing and boosting spin-flipping by aggregation

• Ashish Kumar Mazumdar,
• Gyana Prakash Nanda,
• Nisha Yadav,
• Upasana Deori,
• Upasha Acharyya,
• Bahadur Sk and
• Pachaiyappan Rajamalli

Beilstein J. Org. Chem. 2022, 18, 1177–1187, doi:10.3762/bjoc.18.122

• developed mainly by focusing on photophysical processes, such as photoinduced electron transfer (PET), excited-state intramolecular proton transfer (ESIPT), fluorescence resonance energy transfer (FRET), etc. [21][22][24][25]. Several literature reports have also demonstrated the switching of fluorescence

A Streptomyces P450 enzyme dimerizes isoflavones from plants

• Run-Zhou Liu,
• Shanchong Chen and
• Lihan Zhang

Beilstein J. Org. Chem. 2022, 18, 1107–1115, doi:10.3762/bjoc.18.113

• ://www.geneious.com). Protein purification and biochemical assays The Streptomyces genome was extracted by TIANamp Bacteria DNA Kit (TIANGEN BIOTECH), and the P450 genes were amplified by PCR (Table S1, Supporting Information File 1) and cloned into a pET-28a(+) vector by the T5 exonuclease DNA assembly method [39

On the application of 3d metals for C–H activation toward bioactive compounds: The key step for the synthesis of silver bullets

• Renato L. Carvalho,
• Amanda S. de Miranda,
• Mateus P. Nunes,
• Roberto S. Gomes,
• Guilherme A. M. Jardim and
• Eufrânio N. da Silva Júnior

Beilstein J. Org. Chem. 2021, 17, 1849–1938, doi:10.3762/bjoc.17.126

Development of N-F fluorinating agents and their fluorinations: Historical perspective

• Teruo Umemoto,
• Yuhao Yang and
• Gerald B. Hammond

Beilstein J. Org. Chem. 2021, 17, 1752–1813, doi:10.3762/bjoc.17.123

• -fluorolactams 12-1, was synthesized by Sathyamurthy et al. in 1990 [55]. These compounds had already been prepared by Grakauskas and co-worker in 1970 [56], but in low yields and the N-fluorolactams were not recognized as fluorinating agents at that time. For positron emission tomography (PET), Sathyamurthy et

Sustainable manganese catalysis for late-stage C–H functionalization of bioactive structural motifs

• Jongwoo Son

Beilstein J. Org. Chem. 2021, 17, 1733–1751, doi:10.3762/bjoc.17.122

• radioisotope for positron emission tomography (PET) in clinical and preclinical research is 18F. Radiopharmaceuticals should be prepared at the late stage of the entire synthetic protocol because of the short half-lives of radioisotopes [26][27][28][29]. In their study, the authors used an aqueous 18F-fluoride

Methodologies for the synthesis of quaternary carbon centers via hydroalkylation of unactivated olefins: twenty years of advances

• Thiago S. Silva and
• Fernando Coelho

Beilstein J. Org. Chem. 2021, 17, 1565–1590, doi:10.3762/bjoc.17.112

• reaction rate-determining step in a radical mechanism in which the alkane participates in both the initiation and propagation steps of the radical chain (Scheme 37C). Photoinduced electron transfer Under photoinduced electron transfer (PET) conditions, olefins generate cation radical species that are

• reported that when a polyene 99 or 100 containing an acidic hydrogen in its structure (e.g., a free hydroxy or enol) was subjected to a PET process, the radical cascade was accompanied by a hydrogen shift to give the formal hydroalkylated product 100 or 101 containing a quaternary carbon center (Scheme 38

• reaction was observed in its absence. The authors highlighted the role of the solvent hexafluoro-2-propanol (HFIP) in the stabilization of the radical cation induced by PET and its assistance in the hydrogen shift process. Miscellaneous Lewis acid catalysis in olefin hydroalkylation reactions The ability

Synthetic accesses to biguanide compounds

• Oleksandr Grytsai,
• Cyril Ronco and
• Rachid Benhida

Beilstein J. Org. Chem. 2021, 17, 1001–1040, doi:10.3762/bjoc.17.82

Synthesis of 10-O-aryl-substituted berberine derivatives by Chan–Evans–Lam coupling and investigation of their DNA-binding properties

• Peter Jonas Wickhorst,
• Mathilda Blachnik,
• Denisa Lagumdzija and
• Heiko Ihmels

Beilstein J. Org. Chem. 2021, 17, 991–1000, doi:10.3762/bjoc.17.81

• suppressed rotation about the Ar–O bond. Nevertheless, as the emission quantum yield of the derivatives 5a–e still remained low, even at high viscosity of the medium, there obviously exist additional relaxation pathways in the excited state, most likely a photo-induced electron transfer (PET) from the 10