Search results

Search for "enzymes" in Full Text gives 480 result(s) in Beilstein Journal of Organic Chemistry. Showing first 200.

Mining raw plant transcriptomic data for new cyclopeptide alkaloids

  • Draco Kriger,
  • Michael A. Pasquale,
  • Brigitte G. Ampolini and
  • Jonathan R. Chekan

Beilstein J. Org. Chem. 2024, 20, 1548–1559, doi:10.3762/bjoc.20.138

Graphical Abstract
  • -translational modifications by specific tailoring enzymes [5][6]. This precursor peptide substrate can be subdivided into multiple segments including 1) an N-terminal leader or recognition sequence used for binding by the tailoring enzymes and 2) a core peptide that is targeted for modification by the
  • biosynthetic enzymes. Ultimately proteolysis releases the modified core peptide as the mature RiPP natural product [5][6]. In the case of the newly described burpitide family of RiPPs, the defining feature is the presence of amino acid side-chain crosslinks installed by a copper-dependent burpitide cyclase [4
PDF
Album
Supp Info
Full Research Paper
Published 11 Jul 2024

Computation-guided scaffold exploration of 2E,6E-1,10-trans/cis-eunicellanes

  • Zining Li,
  • Sana Jindani,
  • Volga Kojasoy,
  • Teresa Ortega,
  • Erin M. Marshall,
  • Khalil A. Abboud,
  • Sandra Loesgen,
  • Dean J. Tantillo and
  • Jeffrey D. Rudolf

Beilstein J. Org. Chem. 2024, 20, 1320–1326, doi:10.3762/bjoc.20.115

Graphical Abstract
  • natural products containing a foundational 6/10-bicyclic framework and can be divided into two main classes, cis and trans, based on the configurations of their ring fusion at C1 and C10. Previous studies on two bacterial diterpene synthases, Bnd4 and AlbS, revealed that these enzymes form cis- and trans
  • from bacteria and forms albireticulene (2), a C1 diastereomer of 1 that also features the 2E alkene [7]. Two coral enzymes, BaTC-2 and EcTPS1, were found to form klysimplexin R (3), a 2Z-cis-eunicellane [8][9]. Recently, a third bacterial version, MicA, was identified as producing the 2Z-trans
PDF
Album
Supp Info
Full Research Paper
Published 07 Jun 2024

Cofactor-independent C–C bond cleavage reactions catalyzed by the AlpJ family of oxygenases in atypical angucycline biosynthesis

  • Jinmin Gao,
  • Liyuan Li,
  • Shijie Shen,
  • Guomin Ai,
  • Bin Wang,
  • Fang Guo,
  • Tongjian Yang,
  • Hui Han,
  • Zhengren Xu,
  • Guohui Pan and
  • Keqiang Fan

Beilstein J. Org. Chem. 2024, 20, 1198–1206, doi:10.3762/bjoc.20.102

Graphical Abstract
  • a previously unrecognized facet of these enzymes as cofactor-independent oxygenases when employing the hydroquinone intermediate CR1 as a substrate. The enzymes autonomously drive oxidative ring cleavage and rearrangement reactions of CR1, yielding products identical to those observed in cofactor
  • •−. Our findings illuminate a substrate-controlled catalytic mechanism of AlpJ-family oxygenases, expanding the realm of cofactor-independent oxygenases. Notably, AlpJ-family oxygenases stand as a pioneering example of enzymes capable of catalyzing oxidative reactions in either an FADH2/FMNH2-dependent or
  • and 3 through a rare Mannich reaction. This results in the formation of prekinamycin harboring a diazo group [14]. Given the presence of AlpJ-like oxygenases and ʟ-glutamylhydrazine biosynthetic enzymes in the gene clusters of lomaiviticin, nenestatin, and fluostatins [16][17][18][19][20], it is
PDF
Album
Supp Info
Full Research Paper
Published 23 May 2024

Stability trends in carbocation intermediates stemming from germacrene A and hedycaryol

  • Naziha Tarannam,
  • Prashant Kumar Gupta,
  • Shani Zev and
  • Dan Thomas Major

Beilstein J. Org. Chem. 2024, 20, 1189–1197, doi:10.3762/bjoc.20.101

Graphical Abstract
  • monoterpenes (C10), sesquiterpenes (C15), and diterpenes (C20). Enzymes such as monoterpene, sesquiterpene, and diterpene synthases act on geranyl diphosphate (GPP), farnesyl diphosphate (FPP), and geranylgeranyl diphosphate (GGPP) to yield mono-, sesqui-, and diterpenes, respectively. These linear precursors
  • formation of (6,6) vs (5,7) is rooted in very slight changes in mechanism (protonation at C1 vs C10), it is of interest to understand whether there is a systematic difference in energy. In cases where enzymes use pathways with high-energy intermediates, the enzyme active site must in some way direct the
  • . Interestingly, enzymes which catalyze reactions proceeding via these intermediates must contend with these intrinsic stability tendencies [24][25][27][28][46][47][48][49][50][51]. We further found that the M06-2X functional in conjunction with a modest split valence basis set provides rather accurate energies
PDF
Album
Supp Info
Full Research Paper
Published 23 May 2024

Synthesis of 1,4-azaphosphinine nucleosides and evaluation as inhibitors of human cytidine deaminase and APOBEC3A

  • Maksim V. Kvach,
  • Stefan Harjes,
  • Harikrishnan M. Kurup,
  • Geoffrey B. Jameson,
  • Elena Harjes and
  • Vyacheslav V. Filichev

Beilstein J. Org. Chem. 2024, 20, 1088–1098, doi:10.3762/bjoc.20.96

Graphical Abstract
  • accelerated by enzymes. These enzymes share a similar mechanism of cytosine deamination and a similar tertiary structure. Despite this similarity, individual enzymes are selective for the corresponding cytosine-containing substrates with little or no cross-reactivity. Cytosine deaminase, which is present in
  • (MDS) and chronic myelomonocytic leukaemia (CMML) [8]. In normal human cells, the enzyme family A3 [9][10][11][12] disables pathogens by scrambling ssDNA by cytosine to uracil mutation (Figure 1A) [9][10][13][14]. However, several enzymes, particularly A3A, A3B, A3H and A3G, deaminate cytosine in human
  • , biochemical and structural studies support a model in which this A3-mediated mutagenesis promotes tumour evolution and strongly influences disease trajectories, including the development of drug resistance and metastasis [18][19][20][21][22][23]. Of the seven A3 enzymes, three (A3A, A3B and A3H) are at least
PDF
Album
Supp Info
Full Research Paper
Published 15 May 2024

Novel analogues of a nonnucleoside SARS-CoV-2 RdRp inhibitor as potential antivirotics

  • Luca Julianna Tóth,
  • Kateřina Krejčová,
  • Milan Dejmek,
  • Eva Žilecká,
  • Blanka Klepetářová,
  • Lenka Poštová Slavětínská,
  • Evžen Bouřa and
  • Radim Nencka

Beilstein J. Org. Chem. 2024, 20, 1029–1036, doi:10.3762/bjoc.20.91

Graphical Abstract
  • directly act as a viral messenger RNA and encodes essential enzymes for replication [3]. Inhibiting these nonstructural proteins that are part of the replication complex has already shown great success in antiviral therapy [4][5][6][7]. The viral RNA-dependent RNA polymerase (RdRp) is encoded in all RNA
PDF
Album
Supp Info
Full Research Paper
Published 06 May 2024

Enhancing structural diversity of terpenoids by multisubstrate terpene synthases

  • Min Li and
  • Hui Tao

Beilstein J. Org. Chem. 2024, 20, 959–972, doi:10.3762/bjoc.20.86

Graphical Abstract
  • TaiKang Center for Life and Medical Sciences, Wuhan University, Wuhan, Hubei 430071, China 10.3762/bjoc.20.86 Abstract Terpenoids are one of the largest class of natural products with diverse structures and activities. This enormous diversity is embedded in enzymes called terpene synthases (TSs), which
  • converted into (poly)cyclic skeletons, including hemiterpenes, monoterpenes, sesquiterpenes, diterpenes, sesterterpenes, and triterpenes, by a large class of enzymes called terpene synthases (TSs) (Figure 1). The reactions of TSs are one of the most important factors contributing to terpene diversity, as
  • . Notably, MSTSs can also convert noncanonical prenyl substrates, including chemically synthesized analogs and bio-originated 6-, 7-, 8-, 11-, and 16-carbon substrates generated by methyltransferases or engineered lepidopteran mevalonate pathways. The multisubstrate features of these enzymes have often been
PDF
Album
Review
Published 30 Apr 2024

(Bio)isosteres of ortho- and meta-substituted benzenes

  • H. Erik Diepers and
  • Johannes C. L. Walker

Beilstein J. Org. Chem. 2024, 20, 859–890, doi:10.3762/bjoc.20.78

Graphical Abstract
  • 50% inhibition concentration of selected CYP450 enzymes (IC50). Cis-2,6-disubstituted [2]-ladderanes Brown and co-workers recently proposed cis-2,6-disubstituted bicyclo[2.2.0]hexanes ([2]-ladderanes) as isosteric replacements for meta-benzenes. An exit vector analysis indicated that the substituent
PDF
Album
Review
Published 19 Apr 2024

Activity assays of NnlA homologs suggest the natural product N-nitroglycine is degraded by diverse bacteria

  • Kara A. Strickland,
  • Brenda Martinez Rodriguez,
  • Ashley A. Holland,
  • Shelby Wagner,
  • Michelle Luna-Alva,
  • David E. Graham and
  • Jonathan D. Caranto

Beilstein J. Org. Chem. 2024, 20, 830–840, doi:10.3762/bjoc.20.75

Graphical Abstract
  • NnlA cannot degrade the NNG analog 2-nitroaminoethanol. The combined data strongly suggest that NnlA enzymes specifically degrade NNG and are found in diverse bacteria and environments. These results imply that NNG is also produced in diverse environments and NnlA may act as a detoxification enzyme to
  • metabolic enzymes. In addition, it has been shown to irreversibly inhibit isocitrate lyase 1 (ICL1) from Mycobacterium tuberculosis [40], and key metabolic protein for these pathogens [41]. Isocitrate lyases convert isocitrate to glyoxylate and succinate. Deprotonation of 3NP (pKa = 9.0) results in the
  • noursei, an NNG-producing bacterium, did not reveal any NnlA homologs. Interestingly, four NMOs are annotated in the S. noursei genome. These enzymes could protect S. noursei from NNG toxicity during its biosynthesis. Meanwhile, we posit that NnlA protects non-NNG producing bacteria from exposure. In vivo
PDF
Album
Supp Info
Full Research Paper
Published 17 Apr 2024

Discovery and biosynthesis of bacterial drimane-type sesquiterpenoids from Streptomyces clavuligerus

  • Dongxu Zhang,
  • Wenyu Du,
  • Xingming Pan,
  • Xiaoxu Lin,
  • Fang-Ru Li,
  • Qingling Wang,
  • Qian Yang,
  • Hui-Min Xu and
  • Liao-Bin Dong

Beilstein J. Org. Chem. 2024, 20, 815–822, doi:10.3762/bjoc.20.73

Graphical Abstract
  • performs a similar role to DrtB, engaging two P450s (AncE and AncB) to synthesize (+)-isoantrocin and (−)-antrocin [18]. Notably, the P450s identified in fungi and plants predominantly modify the B-ring of DMTs [15][16][18]. DMTs are commonly found in plants and fungi [6][9][13][15]. While enzymes
  • positions of drimenol (Figure 3d). However, the remaining two P450 enzymes, CavE and CavG, appear to be non-functional either in the native S. clavuligerus or heterologous expression systems. Given the detection of two terpene cyclases (CavC and CavF) and the exclusive DMTs generated, we also speculated
  • that the characterized cav BGC may include two separate BGCs situated closely together. Future efforts will be focused on uncovering the roles of the other three enzymes (CavF, CavE, and CavG). Substrate scope of CavA with drimenol analogs P450s are renowned for their remarkable versatility as
PDF
Album
Supp Info
Full Research Paper
Published 16 Apr 2024

Research progress on the pharmacological activity, biosynthetic pathways, and biosynthesis of crocins

  • Zhongwei Hua,
  • Nan Liu and
  • Xiaohui Yan

Beilstein J. Org. Chem. 2024, 20, 741–752, doi:10.3762/bjoc.20.68

Graphical Abstract
  • also reported to inhibit cell invasion and metastasis [54][55]. Anti-inflammation and antioxidation Crocins exhibit anti-inflammation properties by scavenging free radicals and regulating the expression of antioxidant enzymes. Crocins can inhibit the NF-κB signaling pathway, thus downregulating the
  • enzymes in crocin biosynthetic pathways CCDs: Crocin biosynthesis initiates with the catalytic cleavage of the C‒C double bond by CCDs at various sites of the carotenoid skeleton. The cleavage generates a carbonyl group at the end of the formed carotenoid derivatives [88]. The CCD family can be
  • categorized into the CCD subfamily and the 9-cis-epoxycarotenoid dioxygenase (NCED) subfamily. Five enzymes have been identified within the CCD subfamily: CCD1, CCD2, CCD4, CCD7, and CCD8. In animals, CCDs are involved in retinoid biosynthesis. In plants, CCD1 and CCD7 cleave the 9,10-double bond of
PDF
Album
Review
Published 09 Apr 2024

Substrate specificity of a ketosynthase domain involved in bacillaene biosynthesis

  • Zhiyong Yin and
  • Jeroen S. Dickschat

Beilstein J. Org. Chem. 2024, 20, 734–740, doi:10.3762/bjoc.20.67

Graphical Abstract
  • (PKS). The type I of these enzymes are megasynthases composed of several catalytically active domains that can either act iteratively with the same set of domains catalysing the incorporation of several extender units into a growing polyketide chain, or non-iteratively with one set of domains acting
PDF
Album
Supp Info
Letter
Published 05 Apr 2024

Chemoenzymatic synthesis of macrocyclic peptides and polyketides via thioesterase-catalyzed macrocyclization

  • Senze Qiao,
  • Zhongyu Cheng and
  • Fuzhuo Li

Beilstein J. Org. Chem. 2024, 20, 721–733, doi:10.3762/bjoc.20.66

Graphical Abstract
  • domains along with their associated peptidyl carrier proteins (PCPs): daptomycin and A54145 PCP-TE [55]. A series of thiophenol-activated precursors were tolerated by these enzymes to produce daptomycin derivatives, A54145 as well as hybrid molecules of the two compounds, which pushed forward the better
  • high tolerance for different ring sizes, the sequential explorations of homologous wild-type enzymes and rational protein engineering have broadened the scope of the enzymatic macrolactamization [62]. Antibiotics, wollamide B1 (18) and desprenylagaramide (19), were prepared efficiently using the same
PDF
Album
Review
Published 04 Apr 2024

Genome mining of labdane-related diterpenoids: Discovery of the two-enzyme pathway leading to (−)-sandaracopimaradiene in the fungus Arthrinium sacchari

  • Fumito Sato,
  • Terutaka Sonohara,
  • Shunta Fujiki,
  • Akihiro Sugawara,
  • Yohei Morishita,
  • Taro Ozaki and
  • Teigo Asai

Beilstein J. Org. Chem. 2024, 20, 714–720, doi:10.3762/bjoc.20.65

Graphical Abstract
  • complexity. TCs are generally classified into two main classes, class I and class II. Class I TCs initiate the cyclization by heterolytic cleavage of substrates to generate a diphosphate anion and an allylic carbocation, and class II enzymes start cyclization by protonating a double bond or an epoxide
  • catalyzes these reactions is also known [7]. Bacteria also use two enzyme systems for the biosynthesis of LRDs, but the domain organization of the corresponding TCs is different from those of plant enzymes. In bacteria, the class II enzymes with βγ domains and the class I enzyme with a single α domain are
  • employed [8]. In fungi, only bifunctional enzymes consisting of αβγ tri-domains have been identified to date [9][10][11][12][13]. In the evolutionary aspects, fungal bifunctional TCs are proposed to have been acquired from plants by a horizontal gene transfer event [14] and eukaryotic tri-domain TCs are
PDF
Album
Supp Info
Full Research Paper
Published 03 Apr 2024

New variochelins from soil-isolated Variovorax sp. H002

  • Jabal Rahmat Haedar,
  • Aya Yoshimura and
  • Toshiyuki Wakimoto

Beilstein J. Org. Chem. 2024, 20, 692–700, doi:10.3762/bjoc.20.63

Graphical Abstract
  • : antimicrobial activity; siderophore; variochelin; Variovorax; Introduction Almost all organisms require iron as a crucial cofactor of enzymes essential for their physiological functions, encompassing primary and secondary metabolisms [1]. However, in an aerobic environment, iron predominantly exists in the
  • , we also identified a var gene cluster containing NRPS and PKS genes: the domain organizations of NRPS and PKS, and the adjacently encoded modification enzymes, were comparable to those of the gene cluster reported by Nett et al. with 92–99% identity at the protein level [5] (Figure 3a and Figure S42
PDF
Album
Supp Info
Full Research Paper
Published 02 Apr 2024

Production of non-natural 5-methylorsellinate-derived meroterpenoids in Aspergillus oryzae

  • Jia Tang,
  • Yixiang Zhang and
  • Yudai Matsuda

Beilstein J. Org. Chem. 2024, 20, 638–644, doi:10.3762/bjoc.20.56

Graphical Abstract
  • and three additional biosynthetic enzymes for the formation of (6R,10′R)-epoxyfarnesyl-5-MOA methyl ester, which served as a non-native substrate for four terpene cyclases from DMOA-derived meroterpenoid pathways. As a result, we successfully generated six unnatural 5-MOA-derived meroterpenoid species
  • key role in diversifying the structures of fungal meroterpenoids [16]. For example, (6R,10′R)-epoxyfarnesyl-DMOA methyl ester, a common intermediate with a linear terpenoid moiety, is known to be recognized by five different enzymes, namely Trt1, AusL, AdrI, InsA7, and InsB2, resulting in conversion
  • four enzymes in the Aspergillus oryzae NSARU1 strain [19]. Consequently, the A. oryzae transformant yielded two metabolites 1 and 2, which were absent in the host strain (Figure 2B, traces i and ii). Although we were unable to isolate compounds 1 and 2 because of their instability, high-resolution mass
PDF
Album
Supp Info
Letter
Published 20 Mar 2024

Chemical and biosynthetic potential of Penicillium shentong XL-F41

  • Ran Zou,
  • Xin Li,
  • Xiaochen Chen,
  • Yue-Wei Guo and
  • Baofu Xu

Beilstein J. Org. Chem. 2024, 20, 597–606, doi:10.3762/bjoc.20.52

Graphical Abstract
  • -monooxygenase, to form quinoline rings [26]. Quinine is frequently cited as one of the primary forms of quinoline rings in secondary metabolic pathways. Francesco Trenti et al. [27] studied some of the biosynthesis processes of quinine, in which enzymes involved are much more complex than primary metabolism
  • , such as medium-chain alcohol dehydrogenase (CpDCS), esterase (CpDCE), P450 and O-methyltransferase (CpOMT1) (Figure S37). Through genome excavation and analysis of Penicillium shentong XL-F41, a significant difference was discovered between the key enzymes involved in the formation of product compound
PDF
Album
Supp Info
Full Research Paper
Published 15 Mar 2024

A myo-inositol dehydrogenase involved in aminocyclitol biosynthesis of hygromycin A

  • Michael O. Akintubosun and
  • Melanie A. Higgins

Beilstein J. Org. Chem. 2024, 20, 589–596, doi:10.3762/bjoc.20.51

Graphical Abstract
  • annotations and in vivo studies [8]. However, validation by in vitro approaches or biochemical analysis of the individual enzymes is lacking. Here, we verify that Hyg17 is a myo-inositol dehydrogenase and show that it has a distinct substrate scope. In addition, we use sequence similarity networks to compare
  • is a myo-inositol dehydrogenase. These types of enzymes typically use NAD+ as a cofactor [12][13]. So, we first tested Hyg17 with myo-inositol and NAD+ and found that it was able to produce NADH, suggesting it can function as a myo-inositol dehydrogenase (Figure 2a). Since this assay tests for the
  • Bacillus subtilis, BsIDH, has an optimal pH between 9.5–10 [12][13]. We also compared product formation between reactions with Hyg17 or BsIDH and myo-inositol using thin-layer chromatography (Supporting Information File 1, Figure S3). We found that both enzymes generated a ketone product with identical
PDF
Album
Supp Info
Full Research Paper
Published 14 Mar 2024

Recent developments in the engineered biosynthesis of fungal meroterpenoids

  • Zhiyang Quan and
  • Takayoshi Awakawa

Beilstein J. Org. Chem. 2024, 20, 578–588, doi:10.3762/bjoc.20.50

Graphical Abstract
  • mutagenesis of key enzymes, including terpene cyclases and α-ketoglutarate (αKG)-dependent dioxygenases, that contribute to the structural diversity. Notable progress in genome sequencing has led to the discovery of many novel genes encoding these enzymes, while continued efforts in X-ray crystallographic
  • analyses of these enzymes and the invention of AlphaFold2 have facilitated access to their structures. Structure-based mutagenesis combined with applications of unnatural substrates has further diversified the catalytic repertoire of these enzymes. The information in this review provides useful knowledge
  • will be discussed as examples of engineering biosynthetic pathways and key enzymes involved in fungal meroterpenoid biosynthesis. Furthermore, a construction of the artificial biosynthetic pathway composed of the fungal meroterpenoids pathway and the pathway from other species, in fungal host
PDF
Album
Review
Published 13 Mar 2024

Synthesis and biological profile of 2,3-dihydro[1,3]thiazolo[4,5-b]pyridines, a novel class of acyl-ACP thioesterase inhibitors

  • Jens Frackenpohl,
  • David M. Barber,
  • Guido Bojack,
  • Birgit Bollenbach-Wahl,
  • Ralf Braun,
  • Rahel Getachew,
  • Sabine Hohmann,
  • Kwang-Yoon Ko,
  • Karoline Kurowski,
  • Bernd Laber,
  • Rebecca L. Mattison,
  • Thomas Müller,
  • Anna M. Reingruber,
  • Dirk Schmutzler and
  • Andrea Svejda

Beilstein J. Org. Chem. 2024, 20, 540–551, doi:10.3762/bjoc.20.46

Graphical Abstract
  • with emphasis on the structural diversity of small-molecule ligands. In this context, acyl-acyl carrier protein (acyl-ACP) thioesterase inhibitors have shown a remarkable variability. Fatty acid thioesterase (FAT) enzymes represent a family of proteins exclusively found in higher plants. They mediate
PDF
Album
Supp Info
Full Research Paper
Published 01 Mar 2024

Development of a chemical scaffold for inhibiting nonribosomal peptide synthetases in live bacterial cells

  • Fumihiro Ishikawa,
  • Sho Konno,
  • Hideaki Kakeya and
  • Genzoh Tanabe

Beilstein J. Org. Chem. 2024, 20, 445–451, doi:10.3762/bjoc.20.39

Graphical Abstract
  • investigated the influence of a modification of 2′-OH in the AMS scaffold with different functional groups on binding to target enzymes and bacterial cell penetration. The inhibitor 7 with a cyanomethyl group at 2′-OH showed desirable inhibitory activity against both recombinant and intracellular gramicidin S
  • probes (AA-AMS-BPyne) can selectively label the A-domains corresponding to the amino acid of the ligand in both recombinant enzymes and proteomes. We recently reported that these probes can be used to label the A-domains of endogenous NRPSs in live bacterial cells [17][18][19]. The intracellular labeling
PDF
Album
Supp Info
Full Research Paper
Published 26 Feb 2024

Discovery of unguisin J, a new cyclic peptide from Aspergillus heteromorphus CBS 117.55, and phylogeny-based bioinformatic analysis of UngA NRPS domains

  • Sharmila Neupane,
  • Marcelo Rodrigues de Amorim and
  • Elizabeth Skellam

Beilstein J. Org. Chem. 2024, 20, 321–330, doi:10.3762/bjoc.20.32

Graphical Abstract
  • discovered that linearized the cyclic unguisins to linear peptides during in vitro investigations, although the linear peptides were not detected from the fungal cultures. NRPS enzymes are large multifunctional enzymes that often synthesize very important bioactive molecules [11][12]. These enzymes consist
  • , from Aspergillus heteromorphus CBS 117.55. We also perform bioinformatic analysis of the A and C domains of the UngA NRPS enzymes involved in their biosynthesis to try and rationalize the relaxed substrate specificity observed in this family of heptapeptides. Results and Discussion The cultivation of A
PDF
Album
Supp Info
Full Research Paper
Published 19 Feb 2024

Elucidating the glycan-binding specificity and structure of Cucumis melo agglutinin, a new R-type lectin

  • Jon Lundstrøm,
  • Emilie Gillon,
  • Valérie Chazalet,
  • Nicole Kerekes,
  • Antonio Di Maio,
  • Ten Feizi,
  • Yan Liu,
  • Annabelle Varrot and
  • Daniel Bojar

Beilstein J. Org. Chem. 2024, 20, 306–320, doi:10.3762/bjoc.20.31

Graphical Abstract
  • polymerase (Takara #TAKR045A); then the product was digested by DpnI and finally transformed in NEB5α strain (New England Biolabs, #C2992H). Both gene and vector were digested by NcoI and XhoI restriction enzymes (New England Biolabs) prior to purification on agarose gel using Monarch Gel extraction kit and
  • (ACACCTCGAGTTAGGGTTTGTACTGTGTCACGAACATCC). The primers contained the restriction sites (underlined) NcoI (sense) and XhoI (antisense) on their 5′-ends for further sub-cloning. PCR was performed using PrimeSTAR DNA polymerase. The purified PCR fragment of 395 bp was digested by NcoI and XhoI restriction enzymes, then ligated into pET40b
PDF
Album
Supp Info
Full Research Paper
Published 19 Feb 2024

Photoinduced in situ generation of DNA-targeting ligands: DNA-binding and DNA-photodamaging properties of benzo[c]quinolizinium ions

  • Julika Schlosser,
  • Olga Fedorova,
  • Yuri Fedorov and
  • Heiko Ihmels

Beilstein J. Org. Chem. 2024, 20, 101–117, doi:10.3762/bjoc.20.11

Graphical Abstract
  • a change of the DNA structure or occupy binding sites of essential enzymes, which in turn may influence or even inhibit important biochemical processes, for example DNA replication or transcription [1][2]. As a result, the development of DNA-targeting drugs still involves the design of suitable DNA
PDF
Album
Supp Info
Full Research Paper
Published 18 Jan 2024

Identification of the p-coumaric acid biosynthetic gene cluster in Kutzneria albida: insights into the diazotization-dependent deamination pathway

  • Seiji Kawai,
  • Akito Yamada,
  • Yohei Katsuyama and
  • Yasuo Ohnishi

Beilstein J. Org. Chem. 2024, 20, 1–11, doi:10.3762/bjoc.20.1

Graphical Abstract
  • -nitrosuccinate), from the study on cremeomycin biosynthesis [4][5]. The ANS pathway is composed of two enzymes, CreE (FAD-dependent monooxygenase) and CreD (lyase), to synthesize nitrous acid from ʟ-aspartate and the nitrous acid is used to synthesize the diazo group of cremeomycin [4]. After the discovery of
  • the ANS pathway, it has been shown that the ANS pathway is involved in the nitrogen–nitrogen (N–N) bond formation in the biosynthesis of several natural products [6][7][8]. Enzymes that catalyze N–N bond formation by using nitrous acid from the ANS pathway have also been characterized in several
  • acid through a completely different pathway, which requires at least 12 enzymes and two carrier proteins if two primary metabolites (dihydroxyacetone phosphate and aspartate-4-semialdehyde) are considered as starting materials. Thus, the Cma system appears to be more complicated than the general p
PDF
Album
Supp Info
Full Research Paper
Published 02 Jan 2024
Other Beilstein-Institut Open Science Activities