Search results

Search for "targeting" in Full Text gives 219 result(s) in Beilstein Journal of Organic Chemistry. Showing first 200.

Polyglycerol-functionalized nanodiamond as a platform for gene delivery: Derivatization, characterization, and hybridization with DNA

  • Li Zhao,
  • Yuki Nakae,
  • Hongmei Qin,
  • Tadamasa Ito,
  • Takahide Kimura,
  • Hideto Kojima,
  • Lawrence Chan and
  • Naoki Komatsu

Beilstein J. Org. Chem. 2014, 10, 707–713, doi:10.3762/bjoc.10.64

Graphical Abstract
  • immobilize DNA, more functions such as enough dispersibility and targeting efficacy are required to use ND in vivo as a gene vector. Therefore, a more reliable and general process is desired to add sufficient functions for ND-based gene vectors. Herein a conjugation of ND-PG with basic polypeptides (Arg8
PDF
Album
Full Research Paper
Published 24 Mar 2014

Synthesis of (2S,3R)-3-amino-2-hydroxydecanoic acid and its enantiomer: a non-proteinogenic amino acid segment of the linear pentapeptide microginin

  • Rajendra S. Rohokale and
  • Dilip D. Dhavale

Beilstein J. Org. Chem. 2014, 10, 667–671, doi:10.3762/bjoc.10.59

Graphical Abstract
  • ]. While targeting the synthesis of 2a, the Wittig olefination of 3a with n-hexyltriphenylphosphonium bromide and t-BuOK gave olefin 4a as a diasteromeric mixture of Z and E-isomers in the ratio 9.5:0.5 as shown by 1H NMR of the crude product. The catalytic hydrogenation of alkene 4a with 10% Pd/C in
PDF
Album
Supp Info
Full Research Paper
Published 17 Mar 2014

New sesquiterpene hydroquinones from the Caribbean sponge Aka coralliphagum

  • Qun Göthel and
  • Matthias Köck

Beilstein J. Org. Chem. 2014, 10, 613–621, doi:10.3762/bjoc.10.52

Graphical Abstract
  • , targeting cell lines L929 mouse fibroblasts, KB-31 epidermoid carcinoma, MCF-7 breast cancer, and FS4-LTM conditional immortalization human fibroblasts, respectively. The FS4-LTM cell line was incubated for 24 hours with the tested substances. The other cell lines were incubated for 5 days with the tested
PDF
Album
Supp Info
Full Research Paper
Published 06 Mar 2014

Preparation of new alkyne-modified ansamitocins by mutasynthesis

  • Kirsten Harmrolfs,
  • Lena Mancuso,
  • Binia Drung,
  • Florenz Sasse and
  • Andreas Kirschning

Beilstein J. Org. Chem. 2014, 10, 535–543, doi:10.3762/bjoc.10.49

Graphical Abstract
  • introduce a thiol linker by Huisgen-type cycloaddition which can principally be utilized to create tumor targeting conjugates. In bioactivity tests, only those new ansamitocin derivatives showed strong antiproliferative activity that bear an ester side chain at C-3. Keywords: ansamitocins; antibiotics
  • /ansamitocin conjugates [28] (Scheme 2). Bromo-ansamitocin 6 was obtained by mutasynthesis and was synthetically modified to the complex folic acid/drug conjugate 7. The vitamin folic acid has become a promising ligand for selectively targeting the folate receptor (FR) in cancer tissues where the FR is known
  • antiproliferative activity of the “click” product 27c is remarkable as it demonstrates that substantial structural changes at C20 of the ansamitocins are tolerated and thus alkyne substituents open up diverse opportunities to diversify that position as reported including the introduction of tumor targeting ligands
PDF
Album
Supp Info
Full Research Paper
Published 03 Mar 2014

Intermediates in monensin biosynthesis: A late step in biosynthesis of the polyether ionophore monensin is crucial for the integrity of cation binding

  • Wolfgang Hüttel,
  • Jonathan B. Spencer and
  • Peter F. Leadlay

Beilstein J. Org. Chem. 2014, 10, 361–368, doi:10.3762/bjoc.10.34

Graphical Abstract
  • the S. cinnamonensis strain A519 [19] Redirect©-PCR-targeting technology was used according to the supplier's instructions [21][42]. The disruption cassettes were amplified from a HinDIII-EcoRI-fragment of pIJ773 with the following primers (5' to 3') monD: oD1for: CGGCCGCCACATTCCCCGACCTGGT
PDF
Album
Letter
Published 10 Feb 2014

Recent applications of the divinylcyclopropane–cycloheptadiene rearrangement in organic synthesis

  • Sebastian Krüger and
  • Tanja Gaich

Beilstein J. Org. Chem. 2014, 10, 163–193, doi:10.3762/bjoc.10.14

Graphical Abstract
  • . Gaich et al. [38][39] used the DVCPR in a biosynthetic investigation targeting the dimethylallyltryptophan synthase. In order to test the biosynthetic hypothesis of the mode of action of the 4-prenylation of indoles by Arigoni and Wenkert (starting from L-tryptophan and dimethylallyl pyrophosphate
PDF
Album
Review
Published 16 Jan 2014

Synthesis and biological activity of N-substituted-tetrahydro-γ-carbolines containing peptide residues

  • Nadezhda V. Sokolova,
  • Valentine G. Nenajdenko,
  • Vladimir B. Sokolov,
  • Daria V. Vinogradova,
  • Elena F. Shevtsova,
  • Ludmila G. Dubova and
  • Sergey O. Bachurin

Beilstein J. Org. Chem. 2014, 10, 155–162, doi:10.3762/bjoc.10.13

Graphical Abstract
  • view, mitochondria and the MPT process are very attractive targets for the search of new neuroprotective agents [4][5]. Several promising mitochondria-targeting neuroprotectors have been reported in the literature. Thus, the antihistaminic drug dimebon [6][7], which relates to tetrahydro-γ-carboline
  • derivatives, has been found to stabilize and improve mitochondrial functions in different in vivo and in vitro models [8][9] (Figure 1). Another promising class of neuroprotectors are cell-permeable mitochondria-targeting synthetic small peptides, for example, the SS (Szeto–Schiller) peptide antioxidants [10
PDF
Album
Supp Info
Full Research Paper
Published 15 Jan 2014

Studies toward bivalent κ opioids derived from salvinorin A: heteromethylation of the furan ring reduces affinity

  • Thomas A. Munro,
  • Wei Xu,
  • Douglas M. Ho,
  • Lee-Yuan Liu-Chen and
  • Bruce M. Cohen

Beilstein J. Org. Chem. 2013, 9, 2916–2924, doi:10.3762/bjoc.9.328

Graphical Abstract
  • ligands with a furanylmethyl substituent (Figure 3), we decided to use a short linker. As an alternative approach, bivalent ligands with much longer linkers can bind simultaneously to both protomers in a receptor dimer, allowing selective targeting of specific receptor oligomers [21]. We also sought to
PDF
Album
Supp Info
Full Research Paper
Published 20 Dec 2013

An overview of the synthetic routes to the best selling drugs containing 6-membered heterocycles

  • Marcus Baumann and
  • Ian R. Baxendale

Beilstein J. Org. Chem. 2013, 9, 2265–2319, doi:10.3762/bjoc.9.265

Graphical Abstract
PDF
Album
Review
Published 30 Oct 2013

AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds

  • Qiuping Ding,
  • Dan Wang,
  • Puying Luo,
  • Meiling Liu,
  • Shouzhi Pu and
  • Liyun Zhou

Beilstein J. Org. Chem. 2013, 9, 1949–1956, doi:10.3762/bjoc.9.231

Graphical Abstract
  • single operation, play an important role in atom-economical organic chemistry. A cascade reaction is the most efficient way for targeting fine chemicals, agrochemicals, pharmaceutical drugs, drug intermediates and ingredients by a one-pot reaction in environmentally and economically friendly synthetic
PDF
Album
Supp Info
Full Research Paper
Published 27 Sep 2013

Synthesis and antibacterial activity of monocyclic 3-carboxamide tetramic acids

  • Yong-Chul Jeong and
  • Mark G. Moloney

Beilstein J. Org. Chem. 2013, 9, 1899–1906, doi:10.3762/bjoc.9.224

Graphical Abstract
  • exhibit a dual targeting ability at RNAP and UPPS, while 3-acyl piperidine-2,4-dione 1h only targets UPPS [10]. Although tetramates are well-known as a core component in many natural products that continue to excite interest [11][12][13][14], we carried out a more detailed study of the synthesis
PDF
Album
Supp Info
Full Research Paper
Published 19 Sep 2013

Synthesis of mucin-type O-glycan probes as aminopropyl glycosides

  • David Benito-Alifonso,
  • Rachel A. Jones,
  • Anh-Tuan Tran,
  • Hannah Woodward,
  • Nichola Smith and
  • M. Carmen Galan

Beilstein J. Org. Chem. 2013, 9, 1867–1872, doi:10.3762/bjoc.9.218

Graphical Abstract
  • create a plethora of potential binding sites for commensal and pathogenic microbes, and are also ligands for the targeting of leucocytes to endothelial cells. Secreted mucins found in the intestinal mucus gel and the glycocalyx contain hundreds of different mucin type, O-linked oligosaccharides and
PDF
Album
Supp Info
Full Research Paper
Published 13 Sep 2013

Bioinspired total synthesis of katsumadain A by organocatalytic enantioselective 1,4-conjugate addition

  • Yongguang Wang,
  • Ruiyang Bao,
  • Shengdian Huang and
  • Yefeng Tang

Beilstein J. Org. Chem. 2013, 9, 1601–1606, doi:10.3762/bjoc.9.182

Graphical Abstract
  • copper sulfate-induced emesis in young chicks. More recently, Rollinger et al. disclosed that katsumadain A (1) exhibited prominent in vitro inhibitory activity against the human influenza virus A/PR/8/34 of the subtype H1N1 (IC50 1.05–0.42 μM) by targeting the enzyme neuraminidase (NA) [4][5]. Moreover
PDF
Album
Supp Info
Letter
Published 06 Aug 2013

Synthesis of the calcilytic ligand NPS 2143

  • Henrik Johansson,
  • Thomas Cailly,
  • Alex Rojas Bie Thomsen,
  • Hans Bräuner-Osborne and
  • Daniel Sejer Pedersen

Beilstein J. Org. Chem. 2013, 9, 1383–1387, doi:10.3762/bjoc.9.154

Graphical Abstract
  • major classes (A, B and C) of which the rhodopsin-like class A is the largest and most diverse, and which has been well-studied and subject to drug targeting [3]. GPCR class C is much smaller and comprises only 22 known receptors including eight metabotropic glutamate (mGlu) receptors, two γ
PDF
Album
Supp Info
Full Research Paper
Published 09 Jul 2013

The synthesis of well-defined poly(vinylbenzyl chloride)-grafted nanoparticles via RAFT polymerization

  • John Moraes,
  • Kohji Ohno,
  • Guillaume Gody,
  • Thomas Maschmeyer and
  • Sébastien Perrier

Beilstein J. Org. Chem. 2013, 9, 1226–1234, doi:10.3762/bjoc.9.139

Graphical Abstract
  • conducted at 110 °C in the presence of the RAFT agent 2-(butylthiocarbonothioylthio)propionic acid (PABTC) without any additional initiator. In addition to targeting a high-molecular-weight polymer by choosing a high degree of polymerization (DP), we also prepared polymers of lower molecular weights (DP 100
  • case proceeded at almost identical rates (although Figure 2B shows slight retardation at DP 100, as expected for RAFT polymerization targeting lower DPs, see above), irrespective of the DP, while similar linear semilog kinetics plots for each experiment suggest that the radical flux is constant over
  • adversely affects the Mw/Mn values of the polymers at DP 4,100, which are consistently higher than those at DP 100 (compare experiments 6–10 with experiments 1–5 in Table 1). However, this is an unavoidable consequence of RAFT polymerization under these conditions, when targeting such extremely high DPs
PDF
Album
Supp Info
Full Research Paper
Published 25 Jun 2013

Copper-catalyzed aerobic aliphatic C–H oxygenation with hydroperoxides

  • Pei Chui Too,
  • Ya Lin Tnay and
  • Shunsuke Chiba

Beilstein J. Org. Chem. 2013, 9, 1217–1225, doi:10.3762/bjoc.9.138

Graphical Abstract
  • present aerobic strategy for the synthesis of 1,4-diols by targeting methylene C–H oxygenation with various tertiary hydroperoxides 1 (Table 2). Generally, oxygenation of benzylic methylene C–H bonds proceeded smoothly to give the corresponding 1,4-diols 3 in good to moderate yields (77–51% yields) (Table
PDF
Album
Supp Info
Letter
Published 25 Jun 2013

Exploration of an epoxidation–ring-opening strategy for the synthesis of lyconadin A and discovery of an unexpected Payne rearrangement

  • Brad M. Loertscher,
  • Yu Zhang and
  • Steven L. Castle

Beilstein J. Org. Chem. 2013, 9, 1179–1184, doi:10.3762/bjoc.9.132

Graphical Abstract
  • Brad M. Loertscher Yu Zhang Steven L. Castle Department of Chemistry and Biochemistry, Brigham Young University, C100 BNSN, Provo, UT, 84602, USA 10.3762/bjoc.9.132 Abstract In the context of synthetic efforts targeting the alkaloid lyconadin A, scalemic epoxide 25 was prepared by a highly
  • location of the trityl ether in 26, they do provide compelling evidence that the carbon backbone of this compound is correct as drawn and is produced by a Payne rearrangement of some type. Conclusion In the context of synthetic efforts targeting the polycyclic alkaloid lyconadin A, we prepared scalemic
PDF
Album
Supp Info
Full Research Paper
Published 18 Jun 2013

Synthesis and physicochemical characterization of novel phenotypic probes targeting the nuclear factor-kappa B signaling pathway

  • Paul M. Hershberger,
  • Satyamaheshwar Peddibhotla,
  • E. Hampton Sessions,
  • Daniela B. Divlianska,
  • Ricardo G. Correa,
  • Anthony B. Pinkerton,
  • John C. Reed and
  • Gregory P. Roth

Beilstein J. Org. Chem. 2013, 9, 900–907, doi:10.3762/bjoc.9.103

Graphical Abstract
PDF
Album
Supp Info
Full Research Paper
Published 08 May 2013

Recent progress in the discovery of small molecules for the treatment of amyotrophic lateral sclerosis (ALS)

  • Allison S. Limpert,
  • Margrith E. Mattmann and
  • Nicholas D. P. Cosford

Beilstein J. Org. Chem. 2013, 9, 717–732, doi:10.3762/bjoc.9.82

Graphical Abstract
  • identification of small molecules targeting specific mechanisms of neuronal pathology, including glutamate excitotoxicity, mutant protein aggregation, endoplasmic reticulum (ER) stress, loss of trophic factors, oxidative stress, or neuroinflammation. Herein, we review recent advances in the discovery and
  • the targeting of these mechanisms of cellular dysfunction. Currently, several drugs are in phase III clinical trials for the treatment of ALS (comprehensively reviewed in Glicksman, 2012 [3] and Dunkel et al., 2012 [5]). These drugs include dexpramipexole (2), a mitochondrial stabilizer; arimoclomol
  • ]. Targeting SOD1 mutations Due to the role of SOD1 mutations in fALS and the reproduction of human ALS pathology in mouse models carrying mutant SOD1 genes, one strategy to attenuate ALS pathology is to develop small molecules that reduce SOD1 protein levels. Support for targeting SOD1 protein expression has
PDF
Album
Supp Info
Review
Published 15 Apr 2013

Synthesis of meso-substituted dihydro-1,3-oxazinoporphyrins

  • Satyasheel Sharma and
  • Mahendra Nath

Beilstein J. Org. Chem. 2013, 9, 496–502, doi:10.3762/bjoc.9.53

Graphical Abstract
  • tissue, and efficiency in generating reactive oxygen species by the absorption of photons in the visible or near IR region make them ideal candidates for developing effective photodynamic agents. These findings have encouraged researchers to design and synthesize potential targeting anticancer drugs
PDF
Album
Supp Info
Full Research Paper
Published 07 Mar 2013

Synthesis of 5-(ethylsulfonyl)-2-methoxyaniline: An important pharmacological fragment of VEGFR2 and other inhibitors

  • Miroslav Murár,
  • Gabriela Addová and
  • Andrej Boháč

Beilstein J. Org. Chem. 2013, 9, 173–179, doi:10.3762/bjoc.9.20

Graphical Abstract
  • . Compound 5 is used for the development of small organic compounds, i.e., modulators targeting a broad spectrum of important human protein receptors or enzymes, e.g., VEGFR2, EGFR, PDGFR, TEK kinase, ckit, EphB4, ErbB-2 receptor tyrosine kinase, cyclin-dependent kinases 2 and 4, neu receptor, polo-like
PDF
Album
Full Research Paper
Published 25 Jan 2013

Chemical–biological characterization of a cruzain inhibitor reveals a second target and a mammalian off-target

  • Jonathan W. Choy,
  • Clifford Bryant,
  • Claudia M. Calvet,
  • Patricia S. Doyle,
  • Shamila S. Gunatilleke,
  • Siegfried S. F. Leung,
  • Kenny K. H. Ang,
  • Steven Chen,
  • Jiri Gut,
  • Juan A. Oses-Prieto,
  • Jonathan B. Johnston,
  • Michelle R. Arkin,
  • Alma L. Burlingame,
  • Jack Taunton,
  • Matthew P. Jacobson,
  • James M. McKerrow,
  • Larissa M. Podust and
  • Adam R. Renslo

Beilstein J. Org. Chem. 2013, 9, 15–25, doi:10.3762/bjoc.9.3

Graphical Abstract
  • covered here, there appears to be little rationale for targeting both cruzain and TcCYP51. On the other hand, the surprising potency of analogue 8 does suggest this as a new lead scaffold for the development of novel TcCYP51 inhibitors. We next sought to define the minimal pharmacophore within 8 required
PDF
Album
Supp Info
Full Research Paper
Published 04 Jan 2013

Cyclodextrin-based nanosponges as drug carriers

  • Francesco Trotta,
  • Marco Zanetti and
  • Roberta Cavalli

Beilstein J. Org. Chem. 2012, 8, 2091–2099, doi:10.3762/bjoc.8.235

Graphical Abstract
  • swelling properties. The polarity and dimension of the polymer mesh can be easily tuned by varying the type of cross-linker and degree of cross-linking. Nanosponge functionalisation for site-specific targeting can be achieved by conjugating various ligands on their surface. They are a safe and
  • diagnostic applications. The surface engineering of nanosponges could lead to prolonged residence time in the blood or increased efficiency and specificity with ligands for targeting sites. In conclusion, nanosponges can be considered as multifunctional nanoscale systems suitable for the delivery of active
PDF
Album
Review
Published 29 Nov 2012

Preparation of mixed trialkyl alkylcarbonate derivatives of etidronic acid via an unusual route

  • Petri A. Turhanen,
  • Janne Weisell and
  • Jouko J. Vepsäläinen

Beilstein J. Org. Chem. 2012, 8, 2019–2024, doi:10.3762/bjoc.8.228

Graphical Abstract
  • metabolism, e.g., osteoporosis [2][4]. BPs are also used as bone imaging agents when linked to a gamma-emitting technetium isotope; as bone-targeting promoieties, e.g., for anti-inflammatory drugs [5]; as solvent extraction reagents for actinide ions [6]; and as a new class of herbicides [7]. Recently, BPs
PDF
Album
Supp Info
Full Research Paper
Published 20 Nov 2012

Modulating the activity of short arginine-tryptophan containing antibacterial peptides with N-terminal metallocenoyl groups

  • H. Bauke Albada,
  • Alina-Iulia Chiriac,
  • Michaela Wenzel,
  • Maya Penkova,
  • Julia E. Bandow,
  • Hans-Georg Sahl and
  • Nils Metzler-Nolte

Beilstein J. Org. Chem. 2012, 8, 1753–1764, doi:10.3762/bjoc.8.200

Graphical Abstract
  • and antimicrobial peptides with bacteria-specific membrane targeting modes of action (MOA) to which resistance cannot easily develop has led to high expectations in the treatment of bacterial infections [2][3][4]. Whereas host-defense peptides are found in many multicellular organisms as part of their
  • activities of these RW-based synAMPs and their organometallic conjugates into perspective, two reference peptides were included, i.e., membrane-targeting gramicidin S derivative GS(K2Y2) and cell wall precursor lipid II-targeting vancomycin. For the calculations of the MIC values in µM, molecular weights of
PDF
Album
Video
Full Research Paper
Published 15 Oct 2012
Other Beilstein-Institut Open Science Activities